dwww Home | Manual pages | Find package

PERLRETUT(1)           Perl Programmers Reference Guide           PERLRETUT(1)

NAME
       perlretut - Perl regular expressions tutorial

DESCRIPTION
       This page provides a basic tutorial on understanding, creating and
       using regular expressions in Perl.  It serves as a complement to the
       reference page on regular expressions perlre.  Regular expressions are
       an integral part of the "m//", "s///", "qr//" and "split" operators and
       so this tutorial also overlaps with "Regexp Quote-Like Operators" in
       perlop and "split" in perlfunc.

       Perl is widely renowned for excellence in text processing, and regular
       expressions are one of the big factors behind this fame.  Perl regular
       expressions display an efficiency and flexibility unknown in most other
       computer languages.  Mastering even the basics of regular expressions
       will allow you to manipulate text with surprising ease.

       What is a regular expression?  At its most basic, a regular expression
       is a template that is used to determine if a string has certain
       characteristics.  The string is most often some text, such as a line,
       sentence, web page, or even a whole book, but it doesn't have to be.
       It could be binary data, for example.  Biologists often use Perl to
       look for patterns in long DNA sequences.

       Suppose we want to determine if the text in variable, $var contains the
       sequence of characters "m u s h r o o m" (blanks added for legibility).
       We can write in Perl

        $var =~ m/mushroom/

       The value of this expression will be TRUE if $var contains that
       sequence of characters anywhere within it, and FALSE otherwise.  The
       portion enclosed in '/' characters denotes the characteristic we are
       looking for.  We use the term pattern for it.  The process of looking
       to see if the pattern occurs in the string is called matching, and the
       "=~" operator along with the "m//" tell Perl to try to match the
       pattern against the string.  Note that the pattern is also a string,
       but a very special kind of one, as we will see.  Patterns are in common
       use these days; examples are the patterns typed into a search engine to
       find web pages and the patterns used to list files in a directory,
       e.g., ""ls *.txt"" or ""dir *.*"".  In Perl, the patterns described by
       regular expressions are used not only to search strings, but to also
       extract desired parts of strings, and to do search and replace
       operations.

       Regular expressions have the undeserved reputation of being abstract
       and difficult to understand.  This really stems simply because the
       notation used to express them tends to be terse and dense, and not
       because of inherent complexity.  We recommend using the "/x" regular
       expression modifier (described below) along with plenty of white space
       to make them less dense, and easier to read.  Regular expressions are
       constructed using simple concepts like conditionals and loops and are
       no more difficult to understand than the corresponding "if"
       conditionals and "while" loops in the Perl language itself.

       This tutorial flattens the learning curve by discussing regular
       expression concepts, along with their notation, one at a time and with
       many examples.  The first part of the tutorial will progress from the
       simplest word searches to the basic regular expression concepts.  If
       you master the first part, you will have all the tools needed to solve
       about 98% of your needs.  The second part of the tutorial is for those
       comfortable with the basics and hungry for more power tools.  It
       discusses the more advanced regular expression operators and introduces
       the latest cutting-edge innovations.

       A note: to save time, "regular expression" is often abbreviated as
       regexp or regex.  Regexp is a more natural abbreviation than regex, but
       is harder to pronounce.  The Perl pod documentation is evenly split on
       regexp vs regex; in Perl, there is more than one way to abbreviate it.
       We'll use regexp in this tutorial.

       New in v5.22, "use re 'strict'" applies stricter rules than otherwise
       when compiling regular expression patterns.  It can find things that,
       while legal, may not be what you intended.

Part 1: The basics
   Simple word matching
       The simplest regexp is simply a word, or more generally, a string of
       characters.  A regexp consisting of just a word matches any string that
       contains that word:

           "Hello World" =~ /World/;  # matches

       What is this Perl statement all about? "Hello World" is a simple
       double-quoted string.  "World" is the regular expression and the "//"
       enclosing "/World/" tells Perl to search a string for a match.  The
       operator "=~" associates the string with the regexp match and produces
       a true value if the regexp matched, or false if the regexp did not
       match.  In our case, "World" matches the second word in "Hello World",
       so the expression is true.  Expressions like this are useful in
       conditionals:

           if ("Hello World" =~ /World/) {
               print "It matches\n";
           }
           else {
               print "It doesn't match\n";
           }

       There are useful variations on this theme.  The sense of the match can
       be reversed by using the "!~" operator:

           if ("Hello World" !~ /World/) {
               print "It doesn't match\n";
           }
           else {
               print "It matches\n";
           }

       The literal string in the regexp can be replaced by a variable:

           my $greeting = "World";
           if ("Hello World" =~ /$greeting/) {
               print "It matches\n";
           }
           else {
               print "It doesn't match\n";
           }

       If you're matching against the special default variable $_, the "$_ =~"
       part can be omitted:

           $_ = "Hello World";
           if (/World/) {
               print "It matches\n";
           }
           else {
               print "It doesn't match\n";
           }

       And finally, the "//" default delimiters for a match can be changed to
       arbitrary delimiters by putting an 'm' out front:

           "Hello World" =~ m!World!;   # matches, delimited by '!'
           "Hello World" =~ m{World};   # matches, note the paired '{}'
           "/usr/bin/perl" =~ m"/perl"; # matches after '/usr/bin',
                                        # '/' becomes an ordinary char

       "/World/", "m!World!", and "m{World}" all represent the same thing.
       When, e.g., the quote ('"') is used as a delimiter, the forward slash
       '/' becomes an ordinary character and can be used in this regexp
       without trouble.

       Let's consider how different regexps would match "Hello World":

           "Hello World" =~ /world/;  # doesn't match
           "Hello World" =~ /o W/;    # matches
           "Hello World" =~ /oW/;     # doesn't match
           "Hello World" =~ /World /; # doesn't match

       The first regexp "world" doesn't match because regexps are by default
       case-sensitive.  The second regexp matches because the substring 'o W'
       occurs in the string "Hello World".  The space character ' ' is treated
       like any other character in a regexp and is needed to match in this
       case.  The lack of a space character is the reason the third regexp
       'oW' doesn't match.  The fourth regexp ""World "" doesn't match because
       there is a space at the end of the regexp, but not at the end of the
       string.  The lesson here is that regexps must match a part of the
       string exactly in order for the statement to be true.

       If a regexp matches in more than one place in the string, Perl will
       always match at the earliest possible point in the string:

           "Hello World" =~ /o/;       # matches 'o' in 'Hello'
           "That hat is red" =~ /hat/; # matches 'hat' in 'That'

       With respect to character matching, there are a few more points you
       need to know about.   First of all, not all characters can be used "as-
       is" in a match.  Some characters, called metacharacters, are generally
       reserved for use in regexp notation.  The metacharacters are

           {}[]()^$.|*+?-#\

       This list is not as definitive as it may appear (or be claimed to be in
       other documentation).  For example, "#" is a metacharacter only when
       the "/x" pattern modifier (described below) is used, and both "}" and
       "]" are metacharacters only when paired with opening "{" or "["
       respectively; other gotchas apply.

       The significance of each of these will be explained in the rest of the
       tutorial, but for now, it is important only to know that a
       metacharacter can be matched as-is by putting a backslash before it:

           "2+2=4" =~ /2+2/;    # doesn't match, + is a metacharacter
           "2+2=4" =~ /2\+2/;   # matches, \+ is treated like an ordinary +
           "The interval is [0,1)." =~ /[0,1)./     # is a syntax error!
           "The interval is [0,1)." =~ /\[0,1\)\./  # matches
           "#!/usr/bin/perl" =~ /#!\/usr\/bin\/perl/;  # matches

       In the last regexp, the forward slash '/' is also backslashed, because
       it is used to delimit the regexp.  This can lead to LTS (leaning
       toothpick syndrome), however, and it is often more readable to change
       delimiters.

           "#!/usr/bin/perl" =~ m!#\!/usr/bin/perl!;  # easier to read

       The backslash character '\' is a metacharacter itself and needs to be
       backslashed:

           'C:\WIN32' =~ /C:\\WIN/;   # matches

       In situations where it doesn't make sense for a particular
       metacharacter to mean what it normally does, it automatically loses its
       metacharacter-ness and becomes an ordinary character that is to be
       matched literally.  For example, the '}' is a metacharacter only when
       it is the mate of a '{' metacharacter.  Otherwise it is treated as a
       literal RIGHT CURLY BRACKET.  This may lead to unexpected results.
       "use re 'strict'" can catch some of these.

       In addition to the metacharacters, there are some ASCII characters
       which don't have printable character equivalents and are instead
       represented by escape sequences.  Common examples are "\t" for a tab,
       "\n" for a newline, "\r" for a carriage return and "\a" for a bell (or
       alert).  If your string is better thought of as a sequence of arbitrary
       bytes, the octal escape sequence, e.g., "\033", or hexadecimal escape
       sequence, e.g., "\x1B" may be a more natural representation for your
       bytes.  Here are some examples of escapes:

           "1000\t2000" =~ m(0\t2)   # matches
           "1000\n2000" =~ /0\n20/   # matches
           "1000\t2000" =~ /\000\t2/ # doesn't match, "0" ne "\000"
           "cat"   =~ /\o{143}\x61\x74/ # matches in ASCII, but a weird way
                                        # to spell cat

       If you've been around Perl a while, all this talk of escape sequences
       may seem familiar.  Similar escape sequences are used in double-quoted
       strings and in fact the regexps in Perl are mostly treated as double-
       quoted strings.  This means that variables can be used in regexps as
       well.  Just like double-quoted strings, the values of the variables in
       the regexp will be substituted in before the regexp is evaluated for
       matching purposes.  So we have:

           $foo = 'house';
           'housecat' =~ /$foo/;      # matches
           'cathouse' =~ /cat$foo/;   # matches
           'housecat' =~ /${foo}cat/; # matches

       So far, so good.  With the knowledge above you can already perform
       searches with just about any literal string regexp you can dream up.
       Here is a very simple emulation of the Unix grep program:

           % cat > simple_grep
           #!/usr/bin/perl
           $regexp = shift;
           while (<>) {
               print if /$regexp/;
           }
           ^D

           % chmod +x simple_grep

           % simple_grep abba /usr/dict/words
           Babbage
           cabbage
           cabbages
           sabbath
           Sabbathize
           Sabbathizes
           sabbatical
           scabbard
           scabbards

       This program is easy to understand.  "#!/usr/bin/perl" is the standard
       way to invoke a perl program from the shell.  "$regexp = shift;" saves
       the first command line argument as the regexp to be used, leaving the
       rest of the command line arguments to be treated as files.
       "while (<>)" loops over all the lines in all the files.  For each line,
       "print if /$regexp/;" prints the line if the regexp matches the line.
       In this line, both "print" and "/$regexp/" use the default variable $_
       implicitly.

       With all of the regexps above, if the regexp matched anywhere in the
       string, it was considered a match.  Sometimes, however, we'd like to
       specify where in the string the regexp should try to match.  To do
       this, we would use the anchor metacharacters '^' and '$'.  The anchor
       '^' means match at the beginning of the string and the anchor '$' means
       match at the end of the string, or before a newline at the end of the
       string.  Here is how they are used:

           "housekeeper" =~ /keeper/;    # matches
           "housekeeper" =~ /^keeper/;   # doesn't match
           "housekeeper" =~ /keeper$/;   # matches
           "housekeeper\n" =~ /keeper$/; # matches

       The second regexp doesn't match because '^' constrains "keeper" to
       match only at the beginning of the string, but "housekeeper" has keeper
       starting in the middle.  The third regexp does match, since the '$'
       constrains "keeper" to match only at the end of the string.

       When both '^' and '$' are used at the same time, the regexp has to
       match both the beginning and the end of the string, i.e., the regexp
       matches the whole string.  Consider

           "keeper" =~ /^keep$/;      # doesn't match
           "keeper" =~ /^keeper$/;    # matches
           ""       =~ /^$/;          # ^$ matches an empty string

       The first regexp doesn't match because the string has more to it than
       "keep".  Since the second regexp is exactly the string, it matches.
       Using both '^' and '$' in a regexp forces the complete string to match,
       so it gives you complete control over which strings match and which
       don't.  Suppose you are looking for a fellow named bert, off in a
       string by himself:

           "dogbert" =~ /bert/;   # matches, but not what you want

           "dilbert" =~ /^bert/;  # doesn't match, but ..
           "bertram" =~ /^bert/;  # matches, so still not good enough

           "bertram" =~ /^bert$/; # doesn't match, good
           "dilbert" =~ /^bert$/; # doesn't match, good
           "bert"    =~ /^bert$/; # matches, perfect

       Of course, in the case of a literal string, one could just as easily
       use the string comparison "$string eq 'bert'" and it would be more
       efficient.   The  "^...$" regexp really becomes useful when we add in
       the more powerful regexp tools below.

   Using character classes
       Although one can already do quite a lot with the literal string regexps
       above, we've only scratched the surface of regular expression
       technology.  In this and subsequent sections we will introduce regexp
       concepts (and associated metacharacter notations) that will allow a
       regexp to represent not just a single character sequence, but a whole
       class of them.

       One such concept is that of a character class.  A character class
       allows a set of possible characters, rather than just a single
       character, to match at a particular point in a regexp.  You can define
       your own custom character classes.  These are denoted by brackets
       "[...]", with the set of characters to be possibly matched inside.
       Here are some examples:

           /cat/;       # matches 'cat'
           /[bcr]at/;   # matches 'bat, 'cat', or 'rat'
           /item[0123456789]/;  # matches 'item0' or ... or 'item9'
           "abc" =~ /[cab]/;    # matches 'a'

       In the last statement, even though 'c' is the first character in the
       class, 'a' matches because the first character position in the string
       is the earliest point at which the regexp can match.

           /[yY][eE][sS]/;      # match 'yes' in a case-insensitive way
                                # 'yes', 'Yes', 'YES', etc.

       This regexp displays a common task: perform a case-insensitive match.
       Perl provides a way of avoiding all those brackets by simply appending
       an 'i' to the end of the match.  Then "/[yY][eE][sS]/;" can be
       rewritten as "/yes/i;".  The 'i' stands for case-insensitive and is an
       example of a modifier of the matching operation.  We will meet other
       modifiers later in the tutorial.

       We saw in the section above that there were ordinary characters, which
       represented themselves, and special characters, which needed a
       backslash '\' to represent themselves.  The same is true in a character
       class, but the sets of ordinary and special characters inside a
       character class are different than those outside a character class.
       The special characters for a character class are "-]\^$" (and the
       pattern delimiter, whatever it is).  ']' is special because it denotes
       the end of a character class.  '$' is special because it denotes a
       scalar variable.  '\' is special because it is used in escape
       sequences, just like above.  Here is how the special characters "]$\"
       are handled:

          /[\]c]def/; # matches ']def' or 'cdef'
          $x = 'bcr';
          /[$x]at/;   # matches 'bat', 'cat', or 'rat'
          /[\$x]at/;  # matches '$at' or 'xat'
          /[\\$x]at/; # matches '\at', 'bat, 'cat', or 'rat'

       The last two are a little tricky.  In "[\$x]", the backslash protects
       the dollar sign, so the character class has two members '$' and 'x'.
       In "[\\$x]", the backslash is protected, so $x is treated as a variable
       and substituted in double quote fashion.

       The special character '-' acts as a range operator within character
       classes, so that a contiguous set of characters can be written as a
       range.  With ranges, the unwieldy "[0123456789]" and "[abc...xyz]"
       become the svelte "[0-9]" and "[a-z]".  Some examples are

           /item[0-9]/;  # matches 'item0' or ... or 'item9'
           /[0-9bx-z]aa/;  # matches '0aa', ..., '9aa',
                           # 'baa', 'xaa', 'yaa', or 'zaa'
           /[0-9a-fA-F]/;  # matches a hexadecimal digit
           /[0-9a-zA-Z_]/; # matches a "word" character,
                           # like those in a Perl variable name

       If '-' is the first or last character in a character class, it is
       treated as an ordinary character; "[-ab]", "[ab-]" and "[a\-b]" are all
       equivalent.

       The special character '^' in the first position of a character class
       denotes a negated character class, which matches any character but
       those in the brackets.  Both "[...]" and "[^...]" must match a
       character, or the match fails.  Then

           /[^a]at/;  # doesn't match 'aat' or 'at', but matches
                      # all other 'bat', 'cat, '0at', '%at', etc.
           /[^0-9]/;  # matches a non-numeric character
           /[a^]at/;  # matches 'aat' or '^at'; here '^' is ordinary

       Now, even "[0-9]" can be a bother to write multiple times, so in the
       interest of saving keystrokes and making regexps more readable, Perl
       has several abbreviations for common character classes, as shown below.
       Since the introduction of Unicode, unless the "/a" modifier is in
       effect, these character classes match more than just a few characters
       in the ASCII range.

       •   "\d" matches a digit, not just "[0-9]" but also digits from non-
           roman scripts

       •   "\s" matches a whitespace character, the set "[\ \t\r\n\f]" and
           others

       •   "\w" matches a word character (alphanumeric or '_'), not just
           "[0-9a-zA-Z_]" but also digits and characters from non-roman
           scripts

       •   "\D" is a negated "\d"; it represents any other character than a
           digit, or "[^\d]"

       •   "\S" is a negated "\s"; it represents any non-whitespace character
           "[^\s]"

       •   "\W" is a negated "\w"; it represents any non-word character
           "[^\w]"

       •   The period '.' matches any character but "\n" (unless the modifier
           "/s" is in effect, as explained below).

       •   "\N", like the period, matches any character but "\n", but it does
           so regardless of whether the modifier "/s" is in effect.

       The "/a" modifier, available starting in Perl 5.14,  is used to
       restrict the matches of "\d", "\s", and "\w" to just those in the ASCII
       range.  It is useful to keep your program from being needlessly exposed
       to full Unicode (and its accompanying security considerations) when all
       you want is to process English-like text.  (The "a" may be doubled,
       "/aa", to provide even more restrictions, preventing case-insensitive
       matching of ASCII with non-ASCII characters; otherwise a Unicode
       "Kelvin Sign" would caselessly match a "k" or "K".)

       The "\d\s\w\D\S\W" abbreviations can be used both inside and outside of
       bracketed character classes.  Here are some in use:

           /\d\d:\d\d:\d\d/; # matches a hh:mm:ss time format
           /[\d\s]/;         # matches any digit or whitespace character
           /\w\W\w/;         # matches a word char, followed by a
                             # non-word char, followed by a word char
           /..rt/;           # matches any two chars, followed by 'rt'
           /end\./;          # matches 'end.'
           /end[.]/;         # same thing, matches 'end.'

       Because a period is a metacharacter, it needs to be escaped to match as
       an ordinary period. Because, for example, "\d" and "\w" are sets of
       characters, it is incorrect to think of "[^\d\w]" as "[\D\W]"; in fact
       "[^\d\w]" is the same as "[^\w]", which is the same as "[\W]". Think
       DeMorgan's laws.

       In actuality, the period and "\d\s\w\D\S\W" abbreviations are
       themselves types of character classes, so the ones surrounded by
       brackets are just one type of character class.  When we need to make a
       distinction, we refer to them as "bracketed character classes."

       An anchor useful in basic regexps is the word anchor "\b".  This
       matches a boundary between a word character and a non-word character
       "\w\W" or "\W\w":

           $x = "Housecat catenates house and cat";
           $x =~ /cat/;    # matches cat in 'housecat'
           $x =~ /\bcat/;  # matches cat in 'catenates'
           $x =~ /cat\b/;  # matches cat in 'housecat'
           $x =~ /\bcat\b/;  # matches 'cat' at end of string

       Note in the last example, the end of the string is considered a word
       boundary.

       For natural language processing (so that, for example, apostrophes are
       included in words), use instead "\b{wb}"

           "don't" =~ / .+? \b{wb} /x;  # matches the whole string

       You might wonder why '.' matches everything but "\n" - why not every
       character? The reason is that often one is matching against lines and
       would like to ignore the newline characters.  For instance, while the
       string "\n" represents one line, we would like to think of it as empty.
       Then

           ""   =~ /^$/;    # matches
           "\n" =~ /^$/;    # matches, $ anchors before "\n"

           ""   =~ /./;      # doesn't match; it needs a char
           ""   =~ /^.$/;    # doesn't match; it needs a char
           "\n" =~ /^.$/;    # doesn't match; it needs a char other than "\n"
           "a"  =~ /^.$/;    # matches
           "a\n"  =~ /^.$/;  # matches, $ anchors before "\n"

       This behavior is convenient, because we usually want to ignore newlines
       when we count and match characters in a line.  Sometimes, however, we
       want to keep track of newlines.  We might even want '^' and '$' to
       anchor at the beginning and end of lines within the string, rather than
       just the beginning and end of the string.  Perl allows us to choose
       between ignoring and paying attention to newlines by using the "/s" and
       "/m" modifiers.  "/s" and "/m" stand for single line and multi-line and
       they determine whether a string is to be treated as one continuous
       string, or as a set of lines.  The two modifiers affect two aspects of
       how the regexp is interpreted: 1) how the '.' character class is
       defined, and 2) where the anchors '^' and '$' are able to match.  Here
       are the four possible combinations:

       •   no modifiers: Default behavior.  '.' matches any character except
           "\n".  '^' matches only at the beginning of the string and '$'
           matches only at the end or before a newline at the end.

       •   s modifier ("/s"): Treat string as a single long line.  '.' matches
           any character, even "\n".  '^' matches only at the beginning of the
           string and '$' matches only at the end or before a newline at the
           end.

       •   m modifier ("/m"): Treat string as a set of multiple lines.  '.'
           matches any character except "\n".  '^' and '$' are able to match
           at the start or end of any line within the string.

       •   both s and m modifiers ("/sm"): Treat string as a single long line,
           but detect multiple lines.  '.' matches any character, even "\n".
           '^' and '$', however, are able to match at the start or end of any
           line within the string.

       Here are examples of "/s" and "/m" in action:

           $x = "There once was a girl\nWho programmed in Perl\n";

           $x =~ /^Who/;   # doesn't match, "Who" not at start of string
           $x =~ /^Who/s;  # doesn't match, "Who" not at start of string
           $x =~ /^Who/m;  # matches, "Who" at start of second line
           $x =~ /^Who/sm; # matches, "Who" at start of second line

           $x =~ /girl.Who/;   # doesn't match, "." doesn't match "\n"
           $x =~ /girl.Who/s;  # matches, "." matches "\n"
           $x =~ /girl.Who/m;  # doesn't match, "." doesn't match "\n"
           $x =~ /girl.Who/sm; # matches, "." matches "\n"

       Most of the time, the default behavior is what is wanted, but "/s" and
       "/m" are occasionally very useful.  If "/m" is being used, the start of
       the string can still be matched with "\A" and the end of the string can
       still be matched with the anchors "\Z" (matches both the end and the
       newline before, like '$'), and "\z" (matches only the end):

           $x =~ /^Who/m;   # matches, "Who" at start of second line
           $x =~ /\AWho/m;  # doesn't match, "Who" is not at start of string

           $x =~ /girl$/m;  # matches, "girl" at end of first line
           $x =~ /girl\Z/m; # doesn't match, "girl" is not at end of string

           $x =~ /Perl\Z/m; # matches, "Perl" is at newline before end
           $x =~ /Perl\z/m; # doesn't match, "Perl" is not at end of string

       We now know how to create choices among classes of characters in a
       regexp.  What about choices among words or character strings? Such
       choices are described in the next section.

   Matching this or that
       Sometimes we would like our regexp to be able to match different
       possible words or character strings.  This is accomplished by using the
       alternation metacharacter '|'.  To match "dog" or "cat", we form the
       regexp "dog|cat".  As before, Perl will try to match the regexp at the
       earliest possible point in the string.  At each character position,
       Perl will first try to match the first alternative, "dog".  If "dog"
       doesn't match, Perl will then try the next alternative, "cat".  If
       "cat" doesn't match either, then the match fails and Perl moves to the
       next position in the string.  Some examples:

           "cats and dogs" =~ /cat|dog|bird/;  # matches "cat"
           "cats and dogs" =~ /dog|cat|bird/;  # matches "cat"

       Even though "dog" is the first alternative in the second regexp, "cat"
       is able to match earlier in the string.

           "cats"          =~ /c|ca|cat|cats/; # matches "c"
           "cats"          =~ /cats|cat|ca|c/; # matches "cats"

       Here, all the alternatives match at the first string position, so the
       first alternative is the one that matches.  If some of the alternatives
       are truncations of the others, put the longest ones first to give them
       a chance to match.

           "cab" =~ /a|b|c/ # matches "c"
                            # /a|b|c/ == /[abc]/

       The last example points out that character classes are like
       alternations of characters.  At a given character position, the first
       alternative that allows the regexp match to succeed will be the one
       that matches.

   Grouping things and hierarchical matching
       Alternation allows a regexp to choose among alternatives, but by itself
       it is unsatisfying.  The reason is that each alternative is a whole
       regexp, but sometime we want alternatives for just part of a regexp.
       For instance, suppose we want to search for housecats or housekeepers.
       The regexp "housecat|housekeeper" fits the bill, but is inefficient
       because we had to type "house" twice.  It would be nice to have parts
       of the regexp be constant, like "house", and some parts have
       alternatives, like "cat|keeper".

       The grouping metacharacters "()" solve this problem.  Grouping allows
       parts of a regexp to be treated as a single unit.  Parts of a regexp
       are grouped by enclosing them in parentheses.  Thus we could solve the
       "housecat|housekeeper" by forming the regexp as "house(cat|keeper)".
       The regexp "house(cat|keeper)" means match "house" followed by either
       "cat" or "keeper".  Some more examples are

           /(a|b)b/;    # matches 'ab' or 'bb'
           /(ac|b)b/;   # matches 'acb' or 'bb'
           /(^a|b)c/;   # matches 'ac' at start of string or 'bc' anywhere
           /(a|[bc])d/; # matches 'ad', 'bd', or 'cd'

           /house(cat|)/;  # matches either 'housecat' or 'house'
           /house(cat(s|)|)/;  # matches either 'housecats' or 'housecat' or
                               # 'house'.  Note groups can be nested.

           /(19|20|)\d\d/;  # match years 19xx, 20xx, or the Y2K problem, xx
           "20" =~ /(19|20|)\d\d/;  # matches the null alternative '()\d\d',
                                    # because '20\d\d' can't match

       Alternations behave the same way in groups as out of them: at a given
       string position, the leftmost alternative that allows the regexp to
       match is taken.  So in the last example at the first string position,
       "20" matches the second alternative, but there is nothing left over to
       match the next two digits "\d\d".  So Perl moves on to the next
       alternative, which is the null alternative and that works, since "20"
       is two digits.

       The process of trying one alternative, seeing if it matches, and moving
       on to the next alternative, while going back in the string from where
       the previous alternative was tried, if it doesn't, is called
       backtracking.  The term "backtracking" comes from the idea that
       matching a regexp is like a walk in the woods.  Successfully matching a
       regexp is like arriving at a destination.  There are many possible
       trailheads, one for each string position, and each one is tried in
       order, left to right.  From each trailhead there may be many paths,
       some of which get you there, and some which are dead ends.  When you
       walk along a trail and hit a dead end, you have to backtrack along the
       trail to an earlier point to try another trail.  If you hit your
       destination, you stop immediately and forget about trying all the other
       trails.  You are persistent, and only if you have tried all the trails
       from all the trailheads and not arrived at your destination, do you
       declare failure.  To be concrete, here is a step-by-step analysis of
       what Perl does when it tries to match the regexp

           "abcde" =~ /(abd|abc)(df|d|de)/;

       0. Start with the first letter in the string 'a'.
            

       1. Try the first alternative in the first group 'abd'.
            

       2.  Match 'a' followed by 'b'. So far so good.
            

       3.  'd' in the regexp doesn't match 'c' in the string - a dead end.  So
       backtrack two characters and pick the second alternative in the first
       group 'abc'.
            

       4.  Match 'a' followed by 'b' followed by 'c'.  We are on a roll and
       have satisfied the first group. Set $1 to 'abc'.
            

       5 Move on to the second group and pick the first alternative 'df'.
            

       6 Match the 'd'.
            

       7.  'f' in the regexp doesn't match 'e' in the string, so a dead end.
       Backtrack one character and pick the second alternative in the second
       group 'd'.
            

       8.  'd' matches. The second grouping is satisfied, so set $2 to 'd'.
            

       9.  We are at the end of the regexp, so we are done! We have matched
       'abcd' out of the string "abcde".

       There are a couple of things to note about this analysis.  First, the
       third alternative in the second group 'de' also allows a match, but we
       stopped before we got to it - at a given character position, leftmost
       wins.  Second, we were able to get a match at the first character
       position of the string 'a'.  If there were no matches at the first
       position, Perl would move to the second character position 'b' and
       attempt the match all over again.  Only when all possible paths at all
       possible character positions have been exhausted does Perl give up and
       declare "$string =~ /(abd|abc)(df|d|de)/;" to be false.

       Even with all this work, regexp matching happens remarkably fast.  To
       speed things up, Perl compiles the regexp into a compact sequence of
       opcodes that can often fit inside a processor cache.  When the code is
       executed, these opcodes can then run at full throttle and search very
       quickly.

   Extracting matches
       The grouping metacharacters "()" also serve another completely
       different function: they allow the extraction of the parts of a string
       that matched.  This is very useful to find out what matched and for
       text processing in general.  For each grouping, the part that matched
       inside goes into the special variables $1, $2, etc.  They can be used
       just as ordinary variables:

           # extract hours, minutes, seconds
           if ($time =~ /(\d\d):(\d\d):(\d\d)/) {    # match hh:mm:ss format
               $hours = $1;
               $minutes = $2;
               $seconds = $3;
           }

       Now, we know that in scalar context, "$time =~ /(\d\d):(\d\d):(\d\d)/"
       returns a true or false value.  In list context, however, it returns
       the list of matched values "($1,$2,$3)".  So we could write the code
       more compactly as

           # extract hours, minutes, seconds
           ($hours, $minutes, $second) = ($time =~ /(\d\d):(\d\d):(\d\d)/);

       If the groupings in a regexp are nested, $1 gets the group with the
       leftmost opening parenthesis, $2 the next opening parenthesis, etc.
       Here is a regexp with nested groups:

           /(ab(cd|ef)((gi)|j))/;
            1  2      34

       If this regexp matches, $1 contains a string starting with 'ab', $2 is
       either set to 'cd' or 'ef', $3 equals either 'gi' or 'j', and $4 is
       either set to 'gi', just like $3, or it remains undefined.

       For convenience, Perl sets $+ to the string held by the highest
       numbered $1, $2,... that got assigned (and, somewhat related, $^N to
       the value of the $1, $2,... most-recently assigned; i.e. the $1, $2,...
       associated with the rightmost closing parenthesis used in the match).

   Backreferences
       Closely associated with the matching variables $1, $2, ... are the
       backreferences "\g1", "\g2",...  Backreferences are simply matching
       variables that can be used inside a regexp.  This is a really nice
       feature; what matches later in a regexp is made to depend on what
       matched earlier in the regexp.  Suppose we wanted to look for doubled
       words in a text, like "the the".  The following regexp finds all
       3-letter doubles with a space in between:

           /\b(\w\w\w)\s\g1\b/;

       The grouping assigns a value to "\g1", so that the same 3-letter
       sequence is used for both parts.

       A similar task is to find words consisting of two identical parts:

           % simple_grep '^(\w\w\w\w|\w\w\w|\w\w|\w)\g1$' /usr/dict/words
           beriberi
           booboo
           coco
           mama
           murmur
           papa

       The regexp has a single grouping which considers 4-letter combinations,
       then 3-letter combinations, etc., and uses "\g1" to look for a repeat.
       Although $1 and "\g1" represent the same thing, care should be taken to
       use matched variables $1, $2,... only outside a regexp and
       backreferences "\g1", "\g2",... only inside a regexp; not doing so may
       lead to surprising and unsatisfactory results.

   Relative backreferences
       Counting the opening parentheses to get the correct number for a
       backreference is error-prone as soon as there is more than one
       capturing group.  A more convenient technique became available with
       Perl 5.10: relative backreferences. To refer to the immediately
       preceding capture group one now may write "\g-1" or "\g{-1}", the next
       but last is available via "\g-2" or "\g{-2}", and so on.

       Another good reason in addition to readability and maintainability for
       using relative backreferences is illustrated by the following example,
       where a simple pattern for matching peculiar strings is used:

           $a99a = '([a-z])(\d)\g2\g1';   # matches a11a, g22g, x33x, etc.

       Now that we have this pattern stored as a handy string, we might feel
       tempted to use it as a part of some other pattern:

           $line = "code=e99e";
           if ($line =~ /^(\w+)=$a99a$/){   # unexpected behavior!
               print "$1 is valid\n";
           } else {
               print "bad line: '$line'\n";
           }

       But this doesn't match, at least not the way one might expect. Only
       after inserting the interpolated $a99a and looking at the resulting
       full text of the regexp is it obvious that the backreferences have
       backfired. The subexpression "(\w+)" has snatched number 1 and demoted
       the groups in $a99a by one rank. This can be avoided by using relative
       backreferences:

           $a99a = '([a-z])(\d)\g{-1}\g{-2}';  # safe for being interpolated

   Named backreferences
       Perl 5.10 also introduced named capture groups and named
       backreferences.  To attach a name to a capturing group, you write
       either "(?<name>...)" or "(?'name'...)".  The backreference may then be
       written as "\g{name}".  It is permissible to attach the same name to
       more than one group, but then only the leftmost one of the eponymous
       set can be referenced.  Outside of the pattern a named capture group is
       accessible through the "%+" hash.

       Assuming that we have to match calendar dates which may be given in one
       of the three formats yyyy-mm-dd, mm/dd/yyyy or dd.mm.yyyy, we can write
       three suitable patterns where we use 'd', 'm' and 'y' respectively as
       the names of the groups capturing the pertaining components of a date.
       The matching operation combines the three patterns as alternatives:

           $fmt1 = '(?<y>\d\d\d\d)-(?<m>\d\d)-(?<d>\d\d)';
           $fmt2 = '(?<m>\d\d)/(?<d>\d\d)/(?<y>\d\d\d\d)';
           $fmt3 = '(?<d>\d\d)\.(?<m>\d\d)\.(?<y>\d\d\d\d)';
           for my $d (qw(2006-10-21 15.01.2007 10/31/2005)) {
               if ( $d =~ m{$fmt1|$fmt2|$fmt3} ){
                   print "day=$+{d} month=$+{m} year=$+{y}\n";
               }
           }

       If any of the alternatives matches, the hash "%+" is bound to contain
       the three key-value pairs.

   Alternative capture group numbering
       Yet another capturing group numbering technique (also as from Perl
       5.10) deals with the problem of referring to groups within a set of
       alternatives.  Consider a pattern for matching a time of the day, civil
       or military style:

           if ( $time =~ /(\d\d|\d):(\d\d)|(\d\d)(\d\d)/ ){
               # process hour and minute
           }

       Processing the results requires an additional if statement to determine
       whether $1 and $2 or $3 and $4 contain the goodies. It would be easier
       if we could use group numbers 1 and 2 in second alternative as well,
       and this is exactly what the parenthesized construct "(?|...)", set
       around an alternative achieves. Here is an extended version of the
       previous pattern:

         if($time =~ /(?|(\d\d|\d):(\d\d)|(\d\d)(\d\d))\s+([A-Z][A-Z][A-Z])/){
             print "hour=$1 minute=$2 zone=$3\n";
         }

       Within the alternative numbering group, group numbers start at the same
       position for each alternative. After the group, numbering continues
       with one higher than the maximum reached across all the alternatives.

   Position information
       In addition to what was matched, Perl also provides the positions of
       what was matched as contents of the "@-" and "@+" arrays. "$-[0]" is
       the position of the start of the entire match and $+[0] is the position
       of the end. Similarly, "$-[n]" is the position of the start of the $n
       match and $+[n] is the position of the end. If $n is undefined, so are
       "$-[n]" and $+[n]. Then this code

           $x = "Mmm...donut, thought Homer";
           $x =~ /^(Mmm|Yech)\.\.\.(donut|peas)/; # matches
           foreach $exp (1..$#-) {
               no strict 'refs';
               print "Match $exp: '$$exp' at position ($-[$exp],$+[$exp])\n";
           }

       prints

           Match 1: 'Mmm' at position (0,3)
           Match 2: 'donut' at position (6,11)

       Even if there are no groupings in a regexp, it is still possible to
       find out what exactly matched in a string.  If you use them, Perl will
       set "$`" to the part of the string before the match, will set $& to the
       part of the string that matched, and will set "$'" to the part of the
       string after the match.  An example:

           $x = "the cat caught the mouse";
           $x =~ /cat/;  # $` = 'the ', $& = 'cat', $' = ' caught the mouse'
           $x =~ /the/;  # $` = '', $& = 'the', $' = ' cat caught the mouse'

       In the second match, "$`" equals '' because the regexp matched at the
       first character position in the string and stopped; it never saw the
       second "the".

       If your code is to run on Perl versions earlier than 5.20, it is
       worthwhile to note that using "$`" and "$'" slows down regexp matching
       quite a bit, while $& slows it down to a lesser extent, because if they
       are used in one regexp in a program, they are generated for all regexps
       in the program.  So if raw performance is a goal of your application,
       they should be avoided.  If you need to extract the corresponding
       substrings, use "@-" and "@+" instead:

           $` is the same as substr( $x, 0, $-[0] )
           $& is the same as substr( $x, $-[0], $+[0]-$-[0] )
           $' is the same as substr( $x, $+[0] )

       As of Perl 5.10, the "${^PREMATCH}", "${^MATCH}" and "${^POSTMATCH}"
       variables may be used.  These are only set if the "/p" modifier is
       present.  Consequently they do not penalize the rest of the program.
       In Perl 5.20, "${^PREMATCH}", "${^MATCH}" and "${^POSTMATCH}" are
       available whether the "/p" has been used or not (the modifier is
       ignored), and "$`", "$'" and $& do not cause any speed difference.

   Non-capturing groupings
       A group that is required to bundle a set of alternatives may or may not
       be useful as a capturing group.  If it isn't, it just creates a
       superfluous addition to the set of available capture group values,
       inside as well as outside the regexp.  Non-capturing groupings, denoted
       by "(?:regexp)", still allow the regexp to be treated as a single unit,
       but don't establish a capturing group at the same time.  Both capturing
       and non-capturing groupings are allowed to co-exist in the same regexp.
       Because there is no extraction, non-capturing groupings are faster than
       capturing groupings.  Non-capturing groupings are also handy for
       choosing exactly which parts of a regexp are to be extracted to
       matching variables:

           # match a number, $1-$4 are set, but we only want $1
           /([+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?)/;

           # match a number faster , only $1 is set
           /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE][+-]?\d+)?)/;

           # match a number, get $1 = whole number, $2 = exponent
           /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE]([+-]?\d+))?)/;

       Non-capturing groupings are also useful for removing nuisance elements
       gathered from a split operation where parentheses are required for some
       reason:

           $x = '12aba34ba5';
           @num = split /(a|b)+/, $x;    # @num = ('12','a','34','a','5')
           @num = split /(?:a|b)+/, $x;  # @num = ('12','34','5')

       In Perl 5.22 and later, all groups within a regexp can be set to non-
       capturing by using the new "/n" flag:

           "hello" =~ /(hi|hello)/n; # $1 is not set!

       See "n" in perlre for more information.

   Matching repetitions
       The examples in the previous section display an annoying weakness.  We
       were only matching 3-letter words, or chunks of words of 4 letters or
       less.  We'd like to be able to match words or, more generally, strings
       of any length, without writing out tedious alternatives like
       "\w\w\w\w|\w\w\w|\w\w|\w".

       This is exactly the problem the quantifier metacharacters '?', '*',
       '+', and "{}" were created for.  They allow us to delimit the number of
       repeats for a portion of a regexp we consider to be a match.
       Quantifiers are put immediately after the character, character class,
       or grouping that we want to specify.  They have the following meanings:

       •   "a?" means: match 'a' 1 or 0 times

       •   "a*" means: match 'a' 0 or more times, i.e., any number of times

       •   "a+" means: match 'a' 1 or more times, i.e., at least once

       •   "a{n,m}" means: match at least "n" times, but not more than "m"
           times.

       •   "a{n,}" means: match at least "n" or more times

       •   "a{,n}" means: match at most "n" times, or fewer

       •   "a{n}" means: match exactly "n" times

       If you like, you can add blanks (tab or space characters) within the
       braces, but adjacent to them, and/or next to the comma (if any).

       Here are some examples:

           /[a-z]+\s+\d*/;  # match a lowercase word, at least one space, and
                            # any number of digits
           /(\w+)\s+\g1/;    # match doubled words of arbitrary length
           /y(es)?/i;       # matches 'y', 'Y', or a case-insensitive 'yes'
           $year =~ /^\d{2,4}$/;  # make sure year is at least 2 but not more
                                  # than 4 digits
           $year =~ /^\d{ 2, 4 }$/;    # Same; for those who like wide open
                                       # spaces.
           $year =~ /^\d{2, 4}$/;      # Same.
           $year =~ /^\d{4}$|^\d{2}$/; # better match; throw out 3-digit dates
           $year =~ /^\d{2}(\d{2})?$/; # same thing written differently.
                                       # However, this captures the last two
                                       # digits in $1 and the other does not.

           % simple_grep '^(\w+)\g1$' /usr/dict/words   # isn't this easier?
           beriberi
           booboo
           coco
           mama
           murmur
           papa

       For all of these quantifiers, Perl will try to match as much of the
       string as possible, while still allowing the regexp to succeed.  Thus
       with "/a?.../", Perl will first try to match the regexp with the 'a'
       present; if that fails, Perl will try to match the regexp without the
       'a' present.  For the quantifier '*', we get the following:

           $x = "the cat in the hat";
           $x =~ /^(.*)(cat)(.*)$/; # matches,
                                    # $1 = 'the '
                                    # $2 = 'cat'
                                    # $3 = ' in the hat'

       Which is what we might expect, the match finds the only "cat" in the
       string and locks onto it.  Consider, however, this regexp:

           $x =~ /^(.*)(at)(.*)$/; # matches,
                                   # $1 = 'the cat in the h'
                                   # $2 = 'at'
                                   # $3 = ''   (0 characters match)

       One might initially guess that Perl would find the "at" in "cat" and
       stop there, but that wouldn't give the longest possible string to the
       first quantifier ".*".  Instead, the first quantifier ".*" grabs as
       much of the string as possible while still having the regexp match.  In
       this example, that means having the "at" sequence with the final "at"
       in the string.  The other important principle illustrated here is that,
       when there are two or more elements in a regexp, the leftmost
       quantifier, if there is one, gets to grab as much of the string as
       possible, leaving the rest of the regexp to fight over scraps.  Thus in
       our example, the first quantifier ".*" grabs most of the string, while
       the second quantifier ".*" gets the empty string.   Quantifiers that
       grab as much of the string as possible are called maximal match or
       greedy quantifiers.

       When a regexp can match a string in several different ways, we can use
       the principles above to predict which way the regexp will match:

       •   Principle 0: Taken as a whole, any regexp will be matched at the
           earliest possible position in the string.

       •   Principle 1: In an alternation "a|b|c...", the leftmost alternative
           that allows a match for the whole regexp will be the one used.

       •   Principle 2: The maximal matching quantifiers '?', '*', '+' and
           "{n,m}" will in general match as much of the string as possible
           while still allowing the whole regexp to match.

       •   Principle 3: If there are two or more elements in a regexp, the
           leftmost greedy quantifier, if any, will match as much of the
           string as possible while still allowing the whole regexp to match.
           The next leftmost greedy quantifier, if any, will try to match as
           much of the string remaining available to it as possible, while
           still allowing the whole regexp to match.  And so on, until all the
           regexp elements are satisfied.

       As we have seen above, Principle 0 overrides the others. The regexp
       will be matched as early as possible, with the other principles
       determining how the regexp matches at that earliest character position.

       Here is an example of these principles in action:

           $x = "The programming republic of Perl";
           $x =~ /^(.+)(e|r)(.*)$/;  # matches,
                                     # $1 = 'The programming republic of Pe'
                                     # $2 = 'r'
                                     # $3 = 'l'

       This regexp matches at the earliest string position, 'T'.  One might
       think that 'e', being leftmost in the alternation, would be matched,
       but 'r' produces the longest string in the first quantifier.

           $x =~ /(m{1,2})(.*)$/;  # matches,
                                   # $1 = 'mm'
                                   # $2 = 'ing republic of Perl'

       Here, The earliest possible match is at the first 'm' in "programming".
       "m{1,2}" is the first quantifier, so it gets to match a maximal "mm".

           $x =~ /.*(m{1,2})(.*)$/;  # matches,
                                     # $1 = 'm'
                                     # $2 = 'ing republic of Perl'

       Here, the regexp matches at the start of the string. The first
       quantifier ".*" grabs as much as possible, leaving just a single 'm'
       for the second quantifier "m{1,2}".

           $x =~ /(.?)(m{1,2})(.*)$/;  # matches,
                                       # $1 = 'a'
                                       # $2 = 'mm'
                                       # $3 = 'ing republic of Perl'

       Here, ".?" eats its maximal one character at the earliest possible
       position in the string, 'a' in "programming", leaving "m{1,2}" the
       opportunity to match both 'm''s. Finally,

           "aXXXb" =~ /(X*)/; # matches with $1 = ''

       because it can match zero copies of 'X' at the beginning of the string.
       If you definitely want to match at least one 'X', use "X+", not "X*".

       Sometimes greed is not good.  At times, we would like quantifiers to
       match a minimal piece of string, rather than a maximal piece.  For this
       purpose, Larry Wall created the minimal match or non-greedy quantifiers
       "??", "*?", "+?", and "{}?".  These are the usual quantifiers with a
       '?' appended to them.  They have the following meanings:

       •   "a??" means: match 'a' 0 or 1 times. Try 0 first, then 1.

       •   "a*?" means: match 'a' 0 or more times, i.e., any number of times,
           but as few times as possible

       •   "a+?" means: match 'a' 1 or more times, i.e., at least once, but as
           few times as possible

       •   "a{n,m}?" means: match at least "n" times, not more than "m" times,
           as few times as possible

       •   "a{n,}?" means: match at least "n" times, but as few times as
           possible

       •   "a{,n}?" means: match at most "n" times, but as few times as
           possible

       •   "a{n}?" means: match exactly "n" times.  Because we match exactly
           "n" times, "a{n}?" is equivalent to "a{n}" and is just there for
           notational consistency.

       Let's look at the example above, but with minimal quantifiers:

           $x = "The programming republic of Perl";
           $x =~ /^(.+?)(e|r)(.*)$/; # matches,
                                     # $1 = 'Th'
                                     # $2 = 'e'
                                     # $3 = ' programming republic of Perl'

       The minimal string that will allow both the start of the string '^' and
       the alternation to match is "Th", with the alternation "e|r" matching
       'e'.  The second quantifier ".*" is free to gobble up the rest of the
       string.

           $x =~ /(m{1,2}?)(.*?)$/;  # matches,
                                     # $1 = 'm'
                                     # $2 = 'ming republic of Perl'

       The first string position that this regexp can match is at the first
       'm' in "programming". At this position, the minimal "m{1,2}?"  matches
       just one 'm'.  Although the second quantifier ".*?" would prefer to
       match no characters, it is constrained by the end-of-string anchor '$'
       to match the rest of the string.

           $x =~ /(.*?)(m{1,2}?)(.*)$/;  # matches,
                                         # $1 = 'The progra'
                                         # $2 = 'm'
                                         # $3 = 'ming republic of Perl'

       In this regexp, you might expect the first minimal quantifier ".*?"  to
       match the empty string, because it is not constrained by a '^' anchor
       to match the beginning of the word.  Principle 0 applies here, however.
       Because it is possible for the whole regexp to match at the start of
       the string, it will match at the start of the string.  Thus the first
       quantifier has to match everything up to the first 'm'.  The second
       minimal quantifier matches just one 'm' and the third quantifier
       matches the rest of the string.

           $x =~ /(.??)(m{1,2})(.*)$/;  # matches,
                                        # $1 = 'a'
                                        # $2 = 'mm'
                                        # $3 = 'ing republic of Perl'

       Just as in the previous regexp, the first quantifier ".??" can match
       earliest at position 'a', so it does.  The second quantifier is greedy,
       so it matches "mm", and the third matches the rest of the string.

       We can modify principle 3 above to take into account non-greedy
       quantifiers:

       •   Principle 3: If there are two or more elements in a regexp, the
           leftmost greedy (non-greedy) quantifier, if any, will match as much
           (little) of the string as possible while still allowing the whole
           regexp to match.  The next leftmost greedy (non-greedy) quantifier,
           if any, will try to match as much (little) of the string remaining
           available to it as possible, while still allowing the whole regexp
           to match.  And so on, until all the regexp elements are satisfied.

       Just like alternation, quantifiers are also susceptible to
       backtracking.  Here is a step-by-step analysis of the example

           $x = "the cat in the hat";
           $x =~ /^(.*)(at)(.*)$/; # matches,
                                   # $1 = 'the cat in the h'
                                   # $2 = 'at'
                                   # $3 = ''   (0 matches)

       0.  Start with the first letter in the string 't'.
            

       1.  The first quantifier '.*' starts out by matching the whole string
       ""the cat in the hat"".
            

       2.  'a' in the regexp element 'at' doesn't match the end of the string.
       Backtrack one character.
            

       3.  'a' in the regexp element 'at' still doesn't match the last letter
       of the string 't', so backtrack one more character.
            

       4.  Now we can match the 'a' and the 't'.
            

       5.  Move on to the third element '.*'.  Since we are at the end of the
       string and '.*' can match 0 times, assign it the empty string.
            

       6.  We are done!

       Most of the time, all this moving forward and backtracking happens
       quickly and searching is fast. There are some pathological regexps,
       however, whose execution time exponentially grows with the size of the
       string.  A typical structure that blows up in your face is of the form

           /(a|b+)*/;

       The problem is the nested indeterminate quantifiers.  There are many
       different ways of partitioning a string of length n between the '+' and
       '*': one repetition with "b+" of length n, two repetitions with the
       first "b+" length k and the second with length n-k, m repetitions whose
       bits add up to length n, etc.  In fact there are an exponential number
       of ways to partition a string as a function of its length.  A regexp
       may get lucky and match early in the process, but if there is no match,
       Perl will try every possibility before giving up.  So be careful with
       nested '*''s, "{n,m}"'s, and '+''s.  The book Mastering Regular
       Expressions by Jeffrey Friedl gives a wonderful discussion of this and
       other efficiency issues.

   Possessive quantifiers
       Backtracking during the relentless search for a match may be a waste of
       time, particularly when the match is bound to fail.  Consider the
       simple pattern

           /^\w+\s+\w+$/; # a word, spaces, a word

       Whenever this is applied to a string which doesn't quite meet the
       pattern's expectations such as "abc  " or "abc  def ", the regexp
       engine will backtrack, approximately once for each character in the
       string.  But we know that there is no way around taking all of the
       initial word characters to match the first repetition, that all spaces
       must be eaten by the middle part, and the same goes for the second
       word.

       With the introduction of the possessive quantifiers in Perl 5.10, we
       have a way of instructing the regexp engine not to backtrack, with the
       usual quantifiers with a '+' appended to them.  This makes them greedy
       as well as stingy; once they succeed they won't give anything back to
       permit another solution. They have the following meanings:

       •   "a{n,m}+" means: match at least "n" times, not more than "m" times,
           as many times as possible, and don't give anything up. "a?+" is
           short for "a{0,1}+"

       •   "a{n,}+" means: match at least "n" times, but as many times as
           possible, and don't give anything up. "a++" is short for "a{1,}+".

       •   "a{,n}+" means: match as many times as possible up to at most "n"
           times, and don't give anything up. "a*+" is short for "a{0,}+".

       •   "a{n}+" means: match exactly "n" times.  It is just there for
           notational consistency.

       These possessive quantifiers represent a special case of a more general
       concept, the independent subexpression, see below.

       As an example where a possessive quantifier is suitable we consider
       matching a quoted string, as it appears in several programming
       languages.  The backslash is used as an escape character that indicates
       that the next character is to be taken literally, as another character
       for the string.  Therefore, after the opening quote, we expect a
       (possibly empty) sequence of alternatives: either some character except
       an unescaped quote or backslash or an escaped character.

           /"(?:[^"\\]++|\\.)*+"/;

   Building a regexp
       At this point, we have all the basic regexp concepts covered, so let's
       give a more involved example of a regular expression.  We will build a
       regexp that matches numbers.

       The first task in building a regexp is to decide what we want to match
       and what we want to exclude.  In our case, we want to match both
       integers and floating point numbers and we want to reject any string
       that isn't a number.

       The next task is to break the problem down into smaller problems that
       are easily converted into a regexp.

       The simplest case is integers.  These consist of a sequence of digits,
       with an optional sign in front.  The digits we can represent with "\d+"
       and the sign can be matched with "[+-]".  Thus the integer regexp is

           /[+-]?\d+/;  # matches integers

       A floating point number potentially has a sign, an integral part, a
       decimal point, a fractional part, and an exponent.  One or more of
       these parts is optional, so we need to check out the different
       possibilities.  Floating point numbers which are in proper form include
       123., 0.345, .34, -1e6, and 25.4E-72.  As with integers, the sign out
       front is completely optional and can be matched by "[+-]?".  We can see
       that if there is no exponent, floating point numbers must have a
       decimal point, otherwise they are integers.  We might be tempted to
       model these with "\d*\.\d*", but this would also match just a single
       decimal point, which is not a number.  So the three cases of floating
       point number without exponent are

          /[+-]?\d+\./;  # 1., 321., etc.
          /[+-]?\.\d+/;  # .1, .234, etc.
          /[+-]?\d+\.\d+/;  # 1.0, 30.56, etc.

       These can be combined into a single regexp with a three-way
       alternation:

          /[+-]?(\d+\.\d+|\d+\.|\.\d+)/;  # floating point, no exponent

       In this alternation, it is important to put '\d+\.\d+' before '\d+\.'.
       If '\d+\.' were first, the regexp would happily match that and ignore
       the fractional part of the number.

       Now consider floating point numbers with exponents.  The key
       observation here is that both integers and numbers with decimal points
       are allowed in front of an exponent.  Then exponents, like the overall
       sign, are independent of whether we are matching numbers with or
       without decimal points, and can be "decoupled" from the mantissa.  The
       overall form of the regexp now becomes clear:

           /^(optional sign)(integer | f.p. mantissa)(optional exponent)$/;

       The exponent is an 'e' or 'E', followed by an integer.  So the exponent
       regexp is

          /[eE][+-]?\d+/;  # exponent

       Putting all the parts together, we get a regexp that matches numbers:

          /^[+-]?(\d+\.\d+|\d+\.|\.\d+|\d+)([eE][+-]?\d+)?$/;  # Ta da!

       Long regexps like this may impress your friends, but can be hard to
       decipher.  In complex situations like this, the "/x" modifier for a
       match is invaluable.  It allows one to put nearly arbitrary whitespace
       and comments into a regexp without affecting their meaning.  Using it,
       we can rewrite our "extended" regexp in the more pleasing form

          /^
             [+-]?         # first, match an optional sign
             (             # then match integers or f.p. mantissas:
                 \d+\.\d+  # mantissa of the form a.b
                |\d+\.     # mantissa of the form a.
                |\.\d+     # mantissa of the form .b
                |\d+       # integer of the form a
             )
             ( [eE] [+-]? \d+ )?  # finally, optionally match an exponent
          $/x;

       If whitespace is mostly irrelevant, how does one include space
       characters in an extended regexp? The answer is to backslash it '\ ' or
       put it in a character class "[ ]".  The same thing goes for pound
       signs: use "\#" or "[#]".  For instance, Perl allows a space between
       the sign and the mantissa or integer, and we could add this to our
       regexp as follows:

          /^
             [+-]?\ *      # first, match an optional sign *and space*
             (             # then match integers or f.p. mantissas:
                 \d+\.\d+  # mantissa of the form a.b
                |\d+\.     # mantissa of the form a.
                |\.\d+     # mantissa of the form .b
                |\d+       # integer of the form a
             )
             ( [eE] [+-]? \d+ )?  # finally, optionally match an exponent
          $/x;

       In this form, it is easier to see a way to simplify the alternation.
       Alternatives 1, 2, and 4 all start with "\d+", so it could be factored
       out:

          /^
             [+-]?\ *      # first, match an optional sign
             (             # then match integers or f.p. mantissas:
                 \d+       # start out with a ...
                 (
                     \.\d* # mantissa of the form a.b or a.
                 )?        # ? takes care of integers of the form a
                |\.\d+     # mantissa of the form .b
             )
             ( [eE] [+-]? \d+ )?  # finally, optionally match an exponent
          $/x;

       Starting in Perl v5.26, specifying "/xx" changes the square-bracketed
       portions of a pattern to ignore tabs and space characters unless they
       are escaped by preceding them with a backslash.  So, we could write

          /^
             [ + - ]?\ *   # first, match an optional sign
             (             # then match integers or f.p. mantissas:
                 \d+       # start out with a ...
                 (
                     \.\d* # mantissa of the form a.b or a.
                 )?        # ? takes care of integers of the form a
                |\.\d+     # mantissa of the form .b
             )
             ( [ e E ] [ + - ]? \d+ )?  # finally, optionally match an exponent
          $/xx;

       This doesn't really improve the legibility of this example, but it's
       available in case you want it.  Squashing the pattern down to the
       compact form, we have

           /^[+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?$/;

       This is our final regexp.  To recap, we built a regexp by

       •   specifying the task in detail,

       •   breaking down the problem into smaller parts,

       •   translating the small parts into regexps,

       •   combining the regexps,

       •   and optimizing the final combined regexp.

       These are also the typical steps involved in writing a computer
       program.  This makes perfect sense, because regular expressions are
       essentially programs written in a little computer language that
       specifies patterns.

   Using regular expressions in Perl
       The last topic of Part 1 briefly covers how regexps are used in Perl
       programs.  Where do they fit into Perl syntax?

       We have already introduced the matching operator in its default
       "/regexp/" and arbitrary delimiter "m!regexp!" forms.  We have used the
       binding operator "=~" and its negation "!~" to test for string matches.
       Associated with the matching operator, we have discussed the single
       line "/s", multi-line "/m", case-insensitive "/i" and extended "/x"
       modifiers.  There are a few more things you might want to know about
       matching operators.

       Prohibiting substitution

       If you change $pattern after the first substitution happens, Perl will
       ignore it.  If you don't want any substitutions at all, use the special
       delimiter "m''":

           @pattern = ('Seuss');
           while (<>) {
               print if m'@pattern';  # matches literal '@pattern', not 'Seuss'
           }

       Similar to strings, "m''" acts like apostrophes on a regexp; all other
       'm' delimiters act like quotes.  If the regexp evaluates to the empty
       string, the regexp in the last successful match is used instead.  So we
       have

           "dog" =~ /d/;  # 'd' matches
           "dogbert" =~ //;  # this matches the 'd' regexp used before

       Global matching

       The final two modifiers we will discuss here, "/g" and "/c", concern
       multiple matches.  The modifier "/g" stands for global matching and
       allows the matching operator to match within a string as many times as
       possible.  In scalar context, successive invocations against a string
       will have "/g" jump from match to match, keeping track of position in
       the string as it goes along.  You can get or set the position with the
       "pos()" function.

       The use of "/g" is shown in the following example.  Suppose we have a
       string that consists of words separated by spaces.  If we know how many
       words there are in advance, we could extract the words using groupings:

           $x = "cat dog house"; # 3 words
           $x =~ /^\s*(\w+)\s+(\w+)\s+(\w+)\s*$/; # matches,
                                                  # $1 = 'cat'
                                                  # $2 = 'dog'
                                                  # $3 = 'house'

       But what if we had an indeterminate number of words? This is the sort
       of task "/g" was made for.  To extract all words, form the simple
       regexp "(\w+)" and loop over all matches with "/(\w+)/g":

           while ($x =~ /(\w+)/g) {
               print "Word is $1, ends at position ", pos $x, "\n";
           }

       prints

           Word is cat, ends at position 3
           Word is dog, ends at position 7
           Word is house, ends at position 13

       A failed match or changing the target string resets the position.  If
       you don't want the position reset after failure to match, add the "/c",
       as in "/regexp/gc".  The current position in the string is associated
       with the string, not the regexp.  This means that different strings
       have different positions and their respective positions can be set or
       read independently.

       In list context, "/g" returns a list of matched groupings, or if there
       are no groupings, a list of matches to the whole regexp.  So if we
       wanted just the words, we could use

           @words = ($x =~ /(\w+)/g);  # matches,
                                       # $words[0] = 'cat'
                                       # $words[1] = 'dog'
                                       # $words[2] = 'house'

       Closely associated with the "/g" modifier is the "\G" anchor.  The "\G"
       anchor matches at the point where the previous "/g" match left off.
       "\G" allows us to easily do context-sensitive matching:

           $metric = 1;  # use metric units
           ...
           $x = <FILE>;  # read in measurement
           $x =~ /^([+-]?\d+)\s*/g;  # get magnitude
           $weight = $1;
           if ($metric) { # error checking
               print "Units error!" unless $x =~ /\Gkg\./g;
           }
           else {
               print "Units error!" unless $x =~ /\Glbs\./g;
           }
           $x =~ /\G\s+(widget|sprocket)/g;  # continue processing

       The combination of "/g" and "\G" allows us to process the string a bit
       at a time and use arbitrary Perl logic to decide what to do next.
       Currently, the "\G" anchor is only fully supported when used to anchor
       to the start of the pattern.

       "\G" is also invaluable in processing fixed-length records with
       regexps.  Suppose we have a snippet of coding region DNA, encoded as
       base pair letters "ATCGTTGAAT..." and we want to find all the stop
       codons "TGA".  In a coding region, codons are 3-letter sequences, so we
       can think of the DNA snippet as a sequence of 3-letter records.  The
       naive regexp

           # expanded, this is "ATC GTT GAA TGC AAA TGA CAT GAC"
           $dna = "ATCGTTGAATGCAAATGACATGAC";
           $dna =~ /TGA/;

       doesn't work; it may match a "TGA", but there is no guarantee that the
       match is aligned with codon boundaries, e.g., the substring "GTT GAA"
       gives a match.  A better solution is

           while ($dna =~ /(\w\w\w)*?TGA/g) {  # note the minimal *?
               print "Got a TGA stop codon at position ", pos $dna, "\n";
           }

       which prints

           Got a TGA stop codon at position 18
           Got a TGA stop codon at position 23

       Position 18 is good, but position 23 is bogus.  What happened?

       The answer is that our regexp works well until we get past the last
       real match.  Then the regexp will fail to match a synchronized "TGA"
       and start stepping ahead one character position at a time, not what we
       want.  The solution is to use "\G" to anchor the match to the codon
       alignment:

           while ($dna =~ /\G(\w\w\w)*?TGA/g) {
               print "Got a TGA stop codon at position ", pos $dna, "\n";
           }

       This prints

           Got a TGA stop codon at position 18

       which is the correct answer.  This example illustrates that it is
       important not only to match what is desired, but to reject what is not
       desired.

       (There are other regexp modifiers that are available, such as "/o", but
       their specialized uses are beyond the scope of this introduction.  )

       Search and replace

       Regular expressions also play a big role in search and replace
       operations in Perl.  Search and replace is accomplished with the "s///"
       operator.  The general form is "s/regexp/replacement/modifiers", with
       everything we know about regexps and modifiers applying in this case as
       well.  The replacement is a Perl double-quoted string that replaces in
       the string whatever is matched with the "regexp".  The operator "=~" is
       also used here to associate a string with "s///".  If matching against
       $_, the "$_ =~" can be dropped.  If there is a match, "s///" returns
       the number of substitutions made; otherwise it returns false.  Here are
       a few examples:

           $x = "Time to feed the cat!";
           $x =~ s/cat/hacker/;   # $x contains "Time to feed the hacker!"
           if ($x =~ s/^(Time.*hacker)!$/$1 now!/) {
               $more_insistent = 1;
           }
           $y = "'quoted words'";
           $y =~ s/^'(.*)'$/$1/;  # strip single quotes,
                                  # $y contains "quoted words"

       In the last example, the whole string was matched, but only the part
       inside the single quotes was grouped.  With the "s///" operator, the
       matched variables $1, $2, etc. are immediately available for use in the
       replacement expression, so we use $1 to replace the quoted string with
       just what was quoted.  With the global modifier, "s///g" will search
       and replace all occurrences of the regexp in the string:

           $x = "I batted 4 for 4";
           $x =~ s/4/four/;   # doesn't do it all:
                              # $x contains "I batted four for 4"
           $x = "I batted 4 for 4";
           $x =~ s/4/four/g;  # does it all:
                              # $x contains "I batted four for four"

       If you prefer "regex" over "regexp" in this tutorial, you could use the
       following program to replace it:

           % cat > simple_replace
           #!/usr/bin/perl
           $regexp = shift;
           $replacement = shift;
           while (<>) {
               s/$regexp/$replacement/g;
               print;
           }
           ^D

           % simple_replace regexp regex perlretut.pod

       In "simple_replace" we used the "s///g" modifier to replace all
       occurrences of the regexp on each line.  (Even though the regular
       expression appears in a loop, Perl is smart enough to compile it only
       once.)  As with "simple_grep", both the "print" and the
       "s/$regexp/$replacement/g" use $_ implicitly.

       If you don't want "s///" to change your original variable you can use
       the non-destructive substitute modifier, "s///r".  This changes the
       behavior so that "s///r" returns the final substituted string (instead
       of the number of substitutions):

           $x = "I like dogs.";
           $y = $x =~ s/dogs/cats/r;
           print "$x $y\n";

       That example will print "I like dogs. I like cats". Notice the original
       $x variable has not been affected. The overall result of the
       substitution is instead stored in $y. If the substitution doesn't
       affect anything then the original string is returned:

           $x = "I like dogs.";
           $y = $x =~ s/elephants/cougars/r;
           print "$x $y\n"; # prints "I like dogs. I like dogs."

       One other interesting thing that the "s///r" flag allows is chaining
       substitutions:

           $x = "Cats are great.";
           print $x =~ s/Cats/Dogs/r =~ s/Dogs/Frogs/r =~
               s/Frogs/Hedgehogs/r, "\n";
           # prints "Hedgehogs are great."

       A modifier available specifically to search and replace is the "s///e"
       evaluation modifier.  "s///e" treats the replacement text as Perl code,
       rather than a double-quoted string.  The value that the code returns is
       substituted for the matched substring.  "s///e" is useful if you need
       to do a bit of computation in the process of replacing text.  This
       example counts character frequencies in a line:

           $x = "Bill the cat";
           $x =~ s/(.)/$chars{$1}++;$1/eg; # final $1 replaces char with itself
           print "frequency of '$_' is $chars{$_}\n"
               foreach (sort {$chars{$b} <=> $chars{$a}} keys %chars);

       This prints

           frequency of ' ' is 2
           frequency of 't' is 2
           frequency of 'l' is 2
           frequency of 'B' is 1
           frequency of 'c' is 1
           frequency of 'e' is 1
           frequency of 'h' is 1
           frequency of 'i' is 1
           frequency of 'a' is 1

       As with the match "m//" operator, "s///" can use other delimiters, such
       as "s!!!" and "s{}{}", and even "s{}//".  If single quotes are used
       "s'''", then the regexp and replacement are treated as single-quoted
       strings and there are no variable substitutions.  "s///" in list
       context returns the same thing as in scalar context, i.e., the number
       of matches.

       The split function

       The "split()" function is another place where a regexp is used.  "split
       /regexp/, string, limit" separates the "string" operand into a list of
       substrings and returns that list.  The regexp must be designed to match
       whatever constitutes the separators for the desired substrings.  The
       "limit", if present, constrains splitting into no more than "limit"
       number of strings.  For example, to split a string into words, use

           $x = "Calvin and Hobbes";
           @words = split /\s+/, $x;  # $word[0] = 'Calvin'
                                      # $word[1] = 'and'
                                      # $word[2] = 'Hobbes'

       If the empty regexp "//" is used, the regexp always matches and the
       string is split into individual characters.  If the regexp has
       groupings, then the resulting list contains the matched substrings from
       the groupings as well.  For instance,

           $x = "/usr/bin/perl";
           @dirs = split m!/!, $x;  # $dirs[0] = ''
                                    # $dirs[1] = 'usr'
                                    # $dirs[2] = 'bin'
                                    # $dirs[3] = 'perl'
           @parts = split m!(/)!, $x;  # $parts[0] = ''
                                       # $parts[1] = '/'
                                       # $parts[2] = 'usr'
                                       # $parts[3] = '/'
                                       # $parts[4] = 'bin'
                                       # $parts[5] = '/'
                                       # $parts[6] = 'perl'

       Since the first character of $x matched the regexp, "split" prepended
       an empty initial element to the list.

       If you have read this far, congratulations! You now have all the basic
       tools needed to use regular expressions to solve a wide range of text
       processing problems.  If this is your first time through the tutorial,
       why not stop here and play around with regexps a while....  Part 2
       concerns the more esoteric aspects of regular expressions and those
       concepts certainly aren't needed right at the start.

Part 2: Power tools
       OK, you know the basics of regexps and you want to know more.  If
       matching regular expressions is analogous to a walk in the woods, then
       the tools discussed in Part 1 are analogous to topo maps and a compass,
       basic tools we use all the time.  Most of the tools in part 2 are
       analogous to flare guns and satellite phones.  They aren't used too
       often on a hike, but when we are stuck, they can be invaluable.

       What follows are the more advanced, less used, or sometimes esoteric
       capabilities of Perl regexps.  In Part 2, we will assume you are
       comfortable with the basics and concentrate on the advanced features.

   More on characters, strings, and character classes
       There are a number of escape sequences and character classes that we
       haven't covered yet.

       There are several escape sequences that convert characters or strings
       between upper and lower case, and they are also available within
       patterns.  "\l" and "\u" convert the next character to lower or upper
       case, respectively:

           $x = "perl";
           $string =~ /\u$x/;  # matches 'Perl' in $string
           $x = "M(rs?|s)\\."; # note the double backslash
           $string =~ /\l$x/;  # matches 'mr.', 'mrs.', and 'ms.',

       A "\L" or "\U" indicates a lasting conversion of case, until terminated
       by "\E" or thrown over by another "\U" or "\L":

           $x = "This word is in lower case:\L SHOUT\E";
           $x =~ /shout/;       # matches
           $x = "I STILL KEYPUNCH CARDS FOR MY 360";
           $x =~ /\Ukeypunch/;  # matches punch card string

       If there is no "\E", case is converted until the end of the string. The
       regexps "\L\u$word" or "\u\L$word" convert the first character of $word
       to uppercase and the rest of the characters to lowercase.

       Control characters can be escaped with "\c", so that a control-Z
       character would be matched with "\cZ".  The escape sequence "\Q"..."\E"
       quotes, or protects most non-alphabetic characters.   For instance,

           $x = "\QThat !^*&%~& cat!";
           $x =~ /\Q!^*&%~&\E/;  # check for rough language

       It does not protect '$' or '@', so that variables can still be
       substituted.

       "\Q", "\L", "\l", "\U", "\u" and "\E" are actually part of double-
       quotish syntax, and not part of regexp syntax proper.  They will work
       if they appear in a regular expression embedded directly in a program,
       but not when contained in a string that is interpolated in a pattern.

       Perl regexps can handle more than just the standard ASCII character
       set.  Perl supports Unicode, a standard for representing the alphabets
       from virtually all of the world's written languages, and a host of
       symbols.  Perl's text strings are Unicode strings, so they can contain
       characters with a value (codepoint or character number) higher than
       255.

       What does this mean for regexps? Well, regexp users don't need to know
       much about Perl's internal representation of strings.  But they do need
       to know 1) how to represent Unicode characters in a regexp and 2) that
       a matching operation will treat the string to be searched as a sequence
       of characters, not bytes.  The answer to 1) is that Unicode characters
       greater than "chr(255)" are represented using the "\x{hex}" notation,
       because "\x"XY (without curly braces and XY are two hex digits) doesn't
       go further than 255.  (Starting in Perl 5.14, if you're an octal fan,
       you can also use "\o{oct}".)

           /\x{263a}/;   # match a Unicode smiley face :)
           /\x{ 263a }/; # Same

       NOTE: In Perl 5.6.0 it used to be that one needed to say "use utf8" to
       use any Unicode features.  This is no longer the case: for almost all
       Unicode processing, the explicit "utf8" pragma is not needed.  (The
       only case where it matters is if your Perl script is in Unicode and
       encoded in UTF-8, then an explicit "use utf8" is needed.)

       Figuring out the hexadecimal sequence of a Unicode character you want
       or deciphering someone else's hexadecimal Unicode regexp is about as
       much fun as programming in machine code.  So another way to specify
       Unicode characters is to use the named character escape sequence
       "\N{name}".  name is a name for the Unicode character, as specified in
       the Unicode standard.  For instance, if we wanted to represent or match
       the astrological sign for the planet Mercury, we could use

           $x = "abc\N{MERCURY}def";
           $x =~ /\N{MERCURY}/;   # matches
           $x =~ /\N{ MERCURY }/; # Also matches

       One can also use "short" names:

           print "\N{GREEK SMALL LETTER SIGMA} is called sigma.\n";
           print "\N{greek:Sigma} is an upper-case sigma.\n";

       You can also restrict names to a certain alphabet by specifying the
       charnames pragma:

           use charnames qw(greek);
           print "\N{sigma} is Greek sigma\n";

       An index of character names is available on-line from the Unicode
       Consortium, <https://www.unicode.org/charts/charindex.html>;
       explanatory material with links to other resources at
       <https://www.unicode.org/standard/where>.

       Starting in Perl v5.32, an alternative to "\N{...}" for full names is
       available, and that is to say

        /\p{Name=greek small letter sigma}/

       The casing of the character name is irrelevant when used in "\p{}", as
       are most spaces, underscores and hyphens.  (A few outlier characters
       cause problems with ignoring all of them always.  The details (which
       you can look up when you get more proficient, and if ever needed) are
       in <https://www.unicode.org/reports/tr44/tr44-24.html#UAX44-LM2>).

       The answer to requirement 2) is that a regexp (mostly) uses Unicode
       characters.  The "mostly" is for messy backward compatibility reasons,
       but starting in Perl 5.14, any regexp compiled in the scope of a "use
       feature 'unicode_strings'" (which is automatically turned on within the
       scope of a "use 5.012" or higher) will turn that "mostly" into
       "always".  If you want to handle Unicode properly, you should ensure
       that 'unicode_strings' is turned on.  Internally, this is encoded to
       bytes using either UTF-8 or a native 8 bit encoding, depending on the
       history of the string, but conceptually it is a sequence of characters,
       not bytes. See perlunitut for a tutorial about that.

       Let us now discuss Unicode character classes, most usually called
       "character properties".  These are represented by the "\p{name}" escape
       sequence.  The negation of this is "\P{name}".  For example, to match
       lower and uppercase characters,

           $x = "BOB";
           $x =~ /^\p{IsUpper}/;   # matches, uppercase char class
           $x =~ /^\P{IsUpper}/;   # doesn't match, char class sans uppercase
           $x =~ /^\p{IsLower}/;   # doesn't match, lowercase char class
           $x =~ /^\P{IsLower}/;   # matches, char class sans lowercase

       (The ""Is"" is optional.)

       There are many, many Unicode character properties.  For the full list
       see perluniprops.  Most of them have synonyms with shorter names, also
       listed there.  Some synonyms are a single character.  For these, you
       can drop the braces.  For instance, "\pM" is the same thing as
       "\p{Mark}", meaning things like accent marks.

       The Unicode "\p{Script}" and "\p{Script_Extensions}" properties are
       used to categorize every Unicode character into the language script it
       is written in.  For example, English, French, and a bunch of other
       European languages are written in the Latin script.  But there is also
       the Greek script, the Thai script, the Katakana script, etc.  ("Script"
       is an older, less advanced, form of "Script_Extensions", retained only
       for backwards compatibility.)  You can test whether a character is in a
       particular script  with, for example "\p{Latin}", "\p{Greek}", or
       "\p{Katakana}".  To test if it isn't in the Balinese script, you would
       use "\P{Balinese}".  (These all use "Script_Extensions" under the hood,
       as that gives better results.)

       What we have described so far is the single form of the "\p{...}"
       character classes.  There is also a compound form which you may run
       into.  These look like "\p{name=value}" or "\p{name:value}" (the equals
       sign and colon can be used interchangeably).  These are more general
       than the single form, and in fact most of the single forms are just
       Perl-defined shortcuts for common compound forms.  For example, the
       script examples in the previous paragraph could be written equivalently
       as "\p{Script_Extensions=Latin}", "\p{Script_Extensions:Greek}",
       "\p{script_extensions=katakana}", and "\P{script_extensions=balinese}"
       (case is irrelevant between the "{}" braces).  You may never have to
       use the compound forms, but sometimes it is necessary, and their use
       can make your code easier to understand.

       "\X" is an abbreviation for a character class that comprises a Unicode
       extended grapheme cluster.  This represents a "logical character": what
       appears to be a single character, but may be represented internally by
       more than one.  As an example, using the Unicode full names, e.g.,
       "A + COMBINING RING" is a grapheme cluster with base character "A" and
       combining character "COMBINING RING, which translates in Danish to "A"
       with the circle atop it, as in the word Ångstrom.

       For the full and latest information about Unicode see the latest
       Unicode standard, or the Unicode Consortium's website
       <https://www.unicode.org>

       As if all those classes weren't enough, Perl also defines POSIX-style
       character classes.  These have the form "[:name:]", with name the name
       of the POSIX class.  The POSIX classes are "alpha", "alnum", "ascii",
       "cntrl", "digit", "graph", "lower", "print", "punct", "space", "upper",
       and "xdigit", and two extensions, "word" (a Perl extension to match
       "\w"), and "blank" (a GNU extension).  The "/a" modifier restricts
       these to matching just in the ASCII range; otherwise they can match the
       same as their corresponding Perl Unicode classes: "[:upper:]" is the
       same as "\p{IsUpper}", etc.  (There are some exceptions and gotchas
       with this; see perlrecharclass for a full discussion.) The "[:digit:]",
       "[:word:]", and "[:space:]" correspond to the familiar "\d", "\w", and
       "\s" character classes.  To negate a POSIX class, put a '^' in front of
       the name, so that, e.g., "[:^digit:]" corresponds to "\D" and, under
       Unicode, "\P{IsDigit}".  The Unicode and POSIX character classes can be
       used just like "\d", with the exception that POSIX character classes
       can only be used inside of a character class:

           /\s+[abc[:digit:]xyz]\s*/;  # match a,b,c,x,y,z, or a digit
           /^=item\s[[:digit:]]/;      # match '=item',
                                       # followed by a space and a digit
           /\s+[abc\p{IsDigit}xyz]\s+/;  # match a,b,c,x,y,z, or a digit
           /^=item\s\p{IsDigit}/;        # match '=item',
                                         # followed by a space and a digit

       Whew! That is all the rest of the characters and character classes.

   Compiling and saving regular expressions
       In Part 1 we mentioned that Perl compiles a regexp into a compact
       sequence of opcodes.  Thus, a compiled regexp is a data structure that
       can be stored once and used again and again.  The regexp quote "qr//"
       does exactly that: "qr/string/" compiles the "string" as a regexp and
       transforms the result into a form that can be assigned to a variable:

           $reg = qr/foo+bar?/;  # reg contains a compiled regexp

       Then $reg can be used as a regexp:

           $x = "fooooba";
           $x =~ $reg;     # matches, just like /foo+bar?/
           $x =~ /$reg/;   # same thing, alternate form

       $reg can also be interpolated into a larger regexp:

           $x =~ /(abc)?$reg/;  # still matches

       As with the matching operator, the regexp quote can use different
       delimiters, e.g., "qr!!", "qr{}" or "qr~~".  Apostrophes as delimiters
       ("qr''") inhibit any interpolation.

       Pre-compiled regexps are useful for creating dynamic matches that don't
       need to be recompiled each time they are encountered.  Using pre-
       compiled regexps, we write a "grep_step" program which greps for a
       sequence of patterns, advancing to the next pattern as soon as one has
       been satisfied.

           % cat > grep_step
           #!/usr/bin/perl
           # grep_step - match <number> regexps, one after the other
           # usage: multi_grep <number> regexp1 regexp2 ... file1 file2 ...

           $number = shift;
           $regexp[$_] = shift foreach (0..$number-1);
           @compiled = map qr/$_/, @regexp;
           while ($line = <>) {
               if ($line =~ /$compiled[0]/) {
                   print $line;
                   shift @compiled;
                   last unless @compiled;
               }
           }
           ^D

           % grep_step 3 shift print last grep_step
           $number = shift;
                   print $line;
                   last unless @compiled;

       Storing pre-compiled regexps in an array @compiled allows us to simply
       loop through the regexps without any recompilation, thus gaining
       flexibility without sacrificing speed.

   Composing regular expressions at runtime
       Backtracking is more efficient than repeated tries with different
       regular expressions.  If there are several regular expressions and a
       match with any of them is acceptable, then it is possible to combine
       them into a set of alternatives.  If the individual expressions are
       input data, this can be done by programming a join operation.  We'll
       exploit this idea in an improved version of the "simple_grep" program:
       a program that matches multiple patterns:

           % cat > multi_grep
           #!/usr/bin/perl
           # multi_grep - match any of <number> regexps
           # usage: multi_grep <number> regexp1 regexp2 ... file1 file2 ...

           $number = shift;
           $regexp[$_] = shift foreach (0..$number-1);
           $pattern = join '|', @regexp;

           while ($line = <>) {
               print $line if $line =~ /$pattern/;
           }
           ^D

           % multi_grep 2 shift for multi_grep
           $number = shift;
           $regexp[$_] = shift foreach (0..$number-1);

       Sometimes it is advantageous to construct a pattern from the input that
       is to be analyzed and use the permissible values on the left hand side
       of the matching operations.  As an example for this somewhat
       paradoxical situation, let's assume that our input contains a command
       verb which should match one out of a set of available command verbs,
       with the additional twist that commands may be abbreviated as long as
       the given string is unique. The program below demonstrates the basic
       algorithm.

           % cat > keymatch
           #!/usr/bin/perl
           $kwds = 'copy compare list print';
           while( $cmd = <> ){
               $cmd =~ s/^\s+|\s+$//g;  # trim leading and trailing spaces
               if( ( @matches = $kwds =~ /\b$cmd\w*/g ) == 1 ){
                   print "command: '@matches'\n";
               } elsif( @matches == 0 ){
                   print "no such command: '$cmd'\n";
               } else {
                   print "not unique: '$cmd' (could be one of: @matches)\n";
               }
           }
           ^D

           % keymatch
           li
           command: 'list'
           co
           not unique: 'co' (could be one of: copy compare)
           printer
           no such command: 'printer'

       Rather than trying to match the input against the keywords, we match
       the combined set of keywords against the input.  The pattern matching
       operation "$kwds =~ /\b($cmd\w*)/g" does several things at the same
       time. It makes sure that the given command begins where a keyword
       begins ("\b"). It tolerates abbreviations due to the added "\w*". It
       tells us the number of matches ("scalar @matches") and all the keywords
       that were actually matched.  You could hardly ask for more.

   Embedding comments and modifiers in a regular expression
       Starting with this section, we will be discussing Perl's set of
       extended patterns.  These are extensions to the traditional regular
       expression syntax that provide powerful new tools for pattern matching.
       We have already seen extensions in the form of the minimal matching
       constructs "??", "*?", "+?", "{n,m}?", "{n,}?", and "{,n}?".  Most of
       the extensions below have the form "(?char...)", where the "char" is a
       character that determines the type of extension.

       The first extension is an embedded comment "(?#text)".  This embeds a
       comment into the regular expression without affecting its meaning.  The
       comment should not have any closing parentheses in the text.  An
       example is

           /(?# Match an integer:)[+-]?\d+/;

       This style of commenting has been largely superseded by the raw,
       freeform commenting that is allowed with the "/x" modifier.

       Most modifiers, such as "/i", "/m", "/s" and "/x" (or any combination
       thereof) can also be embedded in a regexp using "(?i)", "(?m)", "(?s)",
       and "(?x)".  For instance,

           /(?i)yes/;  # match 'yes' case insensitively
           /yes/i;     # same thing
           /(?x)(          # freeform version of an integer regexp
                    [+-]?  # match an optional sign
                    \d+    # match a sequence of digits
                )
           /x;

       Embedded modifiers can have two important advantages over the usual
       modifiers.  Embedded modifiers allow a custom set of modifiers for each
       regexp pattern.  This is great for matching an array of regexps that
       must have different modifiers:

           $pattern[0] = '(?i)doctor';
           $pattern[1] = 'Johnson';
           ...
           while (<>) {
               foreach $patt (@pattern) {
                   print if /$patt/;
               }
           }

       The second advantage is that embedded modifiers (except "/p", which
       modifies the entire regexp) only affect the regexp inside the group the
       embedded modifier is contained in.  So grouping can be used to localize
       the modifier's effects:

           /Answer: ((?i)yes)/;  # matches 'Answer: yes', 'Answer: YES', etc.

       Embedded modifiers can also turn off any modifiers already present by
       using, e.g., "(?-i)".  Modifiers can also be combined into a single
       expression, e.g., "(?s-i)" turns on single line mode and turns off case
       insensitivity.

       Embedded modifiers may also be added to a non-capturing grouping.
       "(?i-m:regexp)" is a non-capturing grouping that matches "regexp" case
       insensitively and turns off multi-line mode.

   Looking ahead and looking behind
       This section concerns the lookahead and lookbehind assertions.  First,
       a little background.

       In Perl regular expressions, most regexp elements "eat up" a certain
       amount of string when they match.  For instance, the regexp element
       "[abc]" eats up one character of the string when it matches, in the
       sense that Perl moves to the next character position in the string
       after the match.  There are some elements, however, that don't eat up
       characters (advance the character position) if they match.  The
       examples we have seen so far are the anchors.  The anchor '^' matches
       the beginning of the line, but doesn't eat any characters.  Similarly,
       the word boundary anchor "\b" matches wherever a character matching
       "\w" is next to a character that doesn't, but it doesn't eat up any
       characters itself.  Anchors are examples of zero-width assertions:
       zero-width, because they consume no characters, and assertions, because
       they test some property of the string.  In the context of our walk in
       the woods analogy to regexp matching, most regexp elements move us
       along a trail, but anchors have us stop a moment and check our
       surroundings.  If the local environment checks out, we can proceed
       forward.  But if the local environment doesn't satisfy us, we must
       backtrack.

       Checking the environment entails either looking ahead on the trail,
       looking behind, or both.  '^' looks behind, to see that there are no
       characters before.  '$' looks ahead, to see that there are no
       characters after.  "\b" looks both ahead and behind, to see if the
       characters on either side differ in their "word-ness".

       The lookahead and lookbehind assertions are generalizations of the
       anchor concept.  Lookahead and lookbehind are zero-width assertions
       that let us specify which characters we want to test for.  The
       lookahead assertion is denoted by "(?=regexp)" or (starting in 5.32,
       experimentally in 5.28) "(*pla:regexp)" or
       "(*positive_lookahead:regexp)"; and the lookbehind assertion is denoted
       by "(?<=fixed-regexp)" or (starting in 5.32, experimentally in 5.28)
       "(*plb:fixed-regexp)" or "(*positive_lookbehind:fixed-regexp)".  Some
       examples are

           $x = "I catch the housecat 'Tom-cat' with catnip";
           $x =~ /cat(*pla:\s)/;   # matches 'cat' in 'housecat'
           @catwords = ($x =~ /(?<=\s)cat\w+/g);  # matches,
                                                  # $catwords[0] = 'catch'
                                                  # $catwords[1] = 'catnip'
           $x =~ /\bcat\b/;  # matches 'cat' in 'Tom-cat'
           $x =~ /(?<=\s)cat(?=\s)/; # doesn't match; no isolated 'cat' in
                                     # middle of $x

       Note that the parentheses in these are non-capturing, since these are
       zero-width assertions.  Thus in the second regexp, the substrings
       captured are those of the whole regexp itself.  Lookahead can match
       arbitrary regexps, but lookbehind prior to 5.30 "(?<=fixed-regexp)"
       only works for regexps of fixed width, i.e., a fixed number of
       characters long.  Thus "(?<=(ab|bc))" is fine, but "(?<=(ab)*)" prior
       to 5.30 is not.

       The negated versions of the lookahead and lookbehind assertions are
       denoted by "(?!regexp)" and "(?<!fixed-regexp)" respectively.  Or,
       starting in 5.32 (experimentally in 5.28), "(*nla:regexp)",
       "(*negative_lookahead:regexp)", "(*nlb:regexp)", or
       "(*negative_lookbehind:regexp)".  They evaluate true if the regexps do
       not match:

           $x = "foobar";
           $x =~ /foo(?!bar)/;  # doesn't match, 'bar' follows 'foo'
           $x =~ /foo(?!baz)/;  # matches, 'baz' doesn't follow 'foo'
           $x =~ /(?<!\s)foo/;  # matches, there is no \s before 'foo'

       Here is an example where a string containing blank-separated words,
       numbers and single dashes is to be split into its components.  Using
       "/\s+/" alone won't work, because spaces are not required between
       dashes, or a word or a dash. Additional places for a split are
       established by looking ahead and behind:

           $str = "one two - --6-8";
           @toks = split / \s+              # a run of spaces
                         | (?<=\S) (?=-)    # any non-space followed by '-'
                         | (?<=-)  (?=\S)   # a '-' followed by any non-space
                         /x, $str;          # @toks = qw(one two - - - 6 - 8)

   Using independent subexpressions to prevent backtracking
       Independent subexpressions (or atomic subexpressions) are regular
       expressions, in the context of a larger regular expression, that
       function independently of the larger regular expression.  That is, they
       consume as much or as little of the string as they wish without regard
       for the ability of the larger regexp to match.  Independent
       subexpressions are represented by "(?>regexp)" or (starting in 5.32,
       experimentally in 5.28) "(*atomic:regexp)".  We can illustrate their
       behavior by first considering an ordinary regexp:

           $x = "ab";
           $x =~ /a*ab/;  # matches

       This obviously matches, but in the process of matching, the
       subexpression "a*" first grabbed the 'a'.  Doing so, however, wouldn't
       allow the whole regexp to match, so after backtracking, "a*" eventually
       gave back the 'a' and matched the empty string.  Here, what "a*"
       matched was dependent on what the rest of the regexp matched.

       Contrast that with an independent subexpression:

           $x =~ /(?>a*)ab/;  # doesn't match!

       The independent subexpression "(?>a*)" doesn't care about the rest of
       the regexp, so it sees an 'a' and grabs it.  Then the rest of the
       regexp "ab" cannot match.  Because "(?>a*)" is independent, there is no
       backtracking and the independent subexpression does not give up its
       'a'.  Thus the match of the regexp as a whole fails.  A similar
       behavior occurs with completely independent regexps:

           $x = "ab";
           $x =~ /a*/g;   # matches, eats an 'a'
           $x =~ /\Gab/g; # doesn't match, no 'a' available

       Here "/g" and "\G" create a "tag team" handoff of the string from one
       regexp to the other.  Regexps with an independent subexpression are
       much like this, with a handoff of the string to the independent
       subexpression, and a handoff of the string back to the enclosing
       regexp.

       The ability of an independent subexpression to prevent backtracking can
       be quite useful.  Suppose we want to match a non-empty string enclosed
       in parentheses up to two levels deep.  Then the following regexp
       matches:

           $x = "abc(de(fg)h";  # unbalanced parentheses
           $x =~ /\( ( [ ^ () ]+ | \( [ ^ () ]* \) )+ \)/xx;

       The regexp matches an open parenthesis, one or more copies of an
       alternation, and a close parenthesis.  The alternation is two-way, with
       the first alternative "[^()]+" matching a substring with no parentheses
       and the second alternative "\([^()]*\)"  matching a substring delimited
       by parentheses.  The problem with this regexp is that it is
       pathological: it has nested indeterminate quantifiers of the form
       "(a+|b)+".  We discussed in Part 1 how nested quantifiers like this
       could take an exponentially long time to execute if no match were
       possible.  To prevent the exponential blowup, we need to prevent
       useless backtracking at some point.  This can be done by enclosing the
       inner quantifier as an independent subexpression:

           $x =~ /\( ( (?> [ ^ () ]+ ) | \([ ^ () ]* \) )+ \)/xx;

       Here, "(?>[^()]+)" breaks the degeneracy of string partitioning by
       gobbling up as much of the string as possible and keeping it.   Then
       match failures fail much more quickly.

   Conditional expressions
       A conditional expression is a form of if-then-else statement that
       allows one to choose which patterns are to be matched, based on some
       condition.  There are two types of conditional expression:
       "(?(condition)yes-regexp)" and "(?(condition)yes-regexp|no-regexp)".
       "(?(condition)yes-regexp)" is like an 'if () {}' statement in Perl.  If
       the condition is true, the yes-regexp will be matched.  If the
       condition is false, the yes-regexp will be skipped and Perl will move
       onto the next regexp element.  The second form is like an
       'if () {} else {}' statement in Perl.  If the condition is true, the
       yes-regexp will be matched, otherwise the no-regexp will be matched.

       The condition can have several forms.  The first form is simply an
       integer in parentheses "(integer)".  It is true if the corresponding
       backreference "\integer" matched earlier in the regexp.  The same thing
       can be done with a name associated with a capture group, written as
       "(<name>)" or "('name')".  The second form is a bare zero-width
       assertion "(?...)", either a lookahead, a lookbehind, or a code
       assertion (discussed in the next section).  The third set of forms
       provides tests that return true if the expression is executed within a
       recursion ("(R)") or is being called from some capturing group,
       referenced either by number ("(R1)", "(R2)",...) or by name
       ("(R&name)").

       The integer or name form of the "condition" allows us to choose, with
       more flexibility, what to match based on what matched earlier in the
       regexp. This searches for words of the form "$x$x" or "$x$y$y$x":

           % simple_grep '^(\w+)(\w+)?(?(2)\g2\g1|\g1)$' /usr/dict/words
           beriberi
           coco
           couscous
           deed
           ...
           toot
           toto
           tutu

       The lookbehind "condition" allows, along with backreferences, an
       earlier part of the match to influence a later part of the match.  For
       instance,

           /[ATGC]+(?(?<=AA)G|C)$/;

       matches a DNA sequence such that it either ends in "AAG", or some other
       base pair combination and 'C'.  Note that the form is "(?(?<=AA)G|C)"
       and not "(?((?<=AA))G|C)"; for the lookahead, lookbehind or code
       assertions, the parentheses around the conditional are not needed.

   Defining named patterns
       Some regular expressions use identical subpatterns in several places.
       Starting with Perl 5.10, it is possible to define named subpatterns in
       a section of the pattern so that they can be called up by name anywhere
       in the pattern.  This syntactic pattern for this definition group is
       "(?(DEFINE)(?<name>pattern)...)".  An insertion of a named pattern is
       written as "(?&name)".

       The example below illustrates this feature using the pattern for
       floating point numbers that was presented earlier on.  The three
       subpatterns that are used more than once are the optional sign, the
       digit sequence for an integer and the decimal fraction.  The "DEFINE"
       group at the end of the pattern contains their definition.  Notice that
       the decimal fraction pattern is the first place where we can reuse the
       integer pattern.

          /^ (?&osg)\ * ( (?&int)(?&dec)? | (?&dec) )
             (?: [eE](?&osg)(?&int) )?
           $
           (?(DEFINE)
             (?<osg>[-+]?)         # optional sign
             (?<int>\d++)          # integer
             (?<dec>\.(?&int))     # decimal fraction
           )/x

   Recursive patterns
       This feature (introduced in Perl 5.10) significantly extends the power
       of Perl's pattern matching.  By referring to some other capture group
       anywhere in the pattern with the construct "(?group-ref)", the pattern
       within the referenced group is used as an independent subpattern in
       place of the group reference itself.  Because the group reference may
       be contained within the group it refers to, it is now possible to apply
       pattern matching to tasks that hitherto required a recursive parser.

       To illustrate this feature, we'll design a pattern that matches if a
       string contains a palindrome. (This is a word or a sentence that, while
       ignoring spaces, interpunctuation and case, reads the same backwards as
       forwards. We begin by observing that the empty string or a string
       containing just one word character is a palindrome. Otherwise it must
       have a word character up front and the same at its end, with another
       palindrome in between.

        /(?: (\w) (?...Here be a palindrome...) \g{ -1 } | \w? )/x

       Adding "\W*" at either end to eliminate what is to be ignored, we
       already have the full pattern:

           my $pp = qr/^(\W* (?: (\w) (?1) \g{-1} | \w? ) \W*)$/ix;
           for $s ( "saippuakauppias", "A man, a plan, a canal: Panama!" ){
               print "'$s' is a palindrome\n" if $s =~ /$pp/;
           }

       In "(?...)" both absolute and relative backreferences may be used.  The
       entire pattern can be reinserted with "(?R)" or "(?0)".  If you prefer
       to name your groups, you can use "(?&name)" to recurse into that group.

   A bit of magic: executing Perl code in a regular expression
       Normally, regexps are a part of Perl expressions.  Code evaluation
       expressions turn that around by allowing arbitrary Perl code to be a
       part of a regexp.  A code evaluation expression is denoted "(?{code})",
       with code a string of Perl statements.

       Code expressions are zero-width assertions, and the value they return
       depends on their environment.  There are two possibilities: either the
       code expression is used as a conditional in a conditional expression
       "(?(condition)...)", or it is not.  If the code expression is a
       conditional, the code is evaluated and the result (i.e., the result of
       the last statement) is used to determine truth or falsehood.  If the
       code expression is not used as a conditional, the assertion always
       evaluates true and the result is put into the special variable $^R.
       The variable $^R can then be used in code expressions later in the
       regexp.  Here are some silly examples:

           $x = "abcdef";
           $x =~ /abc(?{print "Hi Mom!";})def/; # matches,
                                                # prints 'Hi Mom!'
           $x =~ /aaa(?{print "Hi Mom!";})def/; # doesn't match,
                                                # no 'Hi Mom!'

       Pay careful attention to the next example:

           $x =~ /abc(?{print "Hi Mom!";})ddd/; # doesn't match,
                                                # no 'Hi Mom!'
                                                # but why not?

       At first glance, you'd think that it shouldn't print, because obviously
       the "ddd" isn't going to match the target string. But look at this
       example:

           $x =~ /abc(?{print "Hi Mom!";})[dD]dd/; # doesn't match,
                                                   # but _does_ print

       Hmm. What happened here? If you've been following along, you know that
       the above pattern should be effectively (almost) the same as the last
       one; enclosing the 'd' in a character class isn't going to change what
       it matches. So why does the first not print while the second one does?

       The answer lies in the optimizations the regexp engine makes. In the
       first case, all the engine sees are plain old characters (aside from
       the "?{}" construct). It's smart enough to realize that the string
       'ddd' doesn't occur in our target string before actually running the
       pattern through. But in the second case, we've tricked it into thinking
       that our pattern is more complicated. It takes a look, sees our
       character class, and decides that it will have to actually run the
       pattern to determine whether or not it matches, and in the process of
       running it hits the print statement before it discovers that we don't
       have a match.

       To take a closer look at how the engine does optimizations, see the
       section "Pragmas and debugging" below.

       More fun with "?{}":

           $x =~ /(?{print "Hi Mom!";})/;         # matches,
                                                  # prints 'Hi Mom!'
           $x =~ /(?{$c = 1;})(?{print "$c";})/;  # matches,
                                                  # prints '1'
           $x =~ /(?{$c = 1;})(?{print "$^R";})/; # matches,
                                                  # prints '1'

       The bit of magic mentioned in the section title occurs when the regexp
       backtracks in the process of searching for a match.  If the regexp
       backtracks over a code expression and if the variables used within are
       localized using "local", the changes in the variables produced by the
       code expression are undone! Thus, if we wanted to count how many times
       a character got matched inside a group, we could use, e.g.,

           $x = "aaaa";
           $count = 0;  # initialize 'a' count
           $c = "bob";  # test if $c gets clobbered
           $x =~ /(?{local $c = 0;})         # initialize count
                  ( a                        # match 'a'
                    (?{local $c = $c + 1;})  # increment count
                  )*                         # do this any number of times,
                  aa                         # but match 'aa' at the end
                  (?{$count = $c;})          # copy local $c var into $count
                 /x;
           print "'a' count is $count, \$c variable is '$c'\n";

       This prints

           'a' count is 2, $c variable is 'bob'

       If we replace the " (?{local $c = $c + 1;})" with " (?{$c = $c + 1;})",
       the variable changes are not undone during backtracking, and we get

           'a' count is 4, $c variable is 'bob'

       Note that only localized variable changes are undone.  Other side
       effects of code expression execution are permanent.  Thus

           $x = "aaaa";
           $x =~ /(a(?{print "Yow\n";}))*aa/;

       produces

          Yow
          Yow
          Yow
          Yow

       The result $^R is automatically localized, so that it will behave
       properly in the presence of backtracking.

       This example uses a code expression in a conditional to match a
       definite article, either 'the' in English or 'der|die|das' in German:

           $lang = 'DE';  # use German
           ...
           $text = "das";
           print "matched\n"
               if $text =~ /(?(?{
                                 $lang eq 'EN'; # is the language English?
                                })
                              the |             # if so, then match 'the'
                              (der|die|das)     # else, match 'der|die|das'
                            )
                           /xi;

       Note that the syntax here is "(?(?{...})yes-regexp|no-regexp)", not
       "(?((?{...}))yes-regexp|no-regexp)".  In other words, in the case of a
       code expression, we don't need the extra parentheses around the
       conditional.

       If you try to use code expressions where the code text is contained
       within an interpolated variable, rather than appearing literally in the
       pattern, Perl may surprise you:

           $bar = 5;
           $pat = '(?{ 1 })';
           /foo(?{ $bar })bar/; # compiles ok, $bar not interpolated
           /foo(?{ 1 })$bar/;   # compiles ok, $bar interpolated
           /foo${pat}bar/;      # compile error!

           $pat = qr/(?{ $foo = 1 })/;  # precompile code regexp
           /foo${pat}bar/;      # compiles ok

       If a regexp has a variable that interpolates a code expression, Perl
       treats the regexp as an error. If the code expression is precompiled
       into a variable, however, interpolating is ok. The question is, why is
       this an error?

       The reason is that variable interpolation and code expressions together
       pose a security risk.  The combination is dangerous because many
       programmers who write search engines often take user input and plug it
       directly into a regexp:

           $regexp = <>;       # read user-supplied regexp
           $chomp $regexp;     # get rid of possible newline
           $text =~ /$regexp/; # search $text for the $regexp

       If the $regexp variable contains a code expression, the user could then
       execute arbitrary Perl code.  For instance, some joker could search for
       "system('rm -rf *');" to erase your files.  In this sense, the
       combination of interpolation and code expressions taints your regexp.
       So by default, using both interpolation and code expressions in the
       same regexp is not allowed.  If you're not concerned about malicious
       users, it is possible to bypass this security check by invoking
       "use re 'eval'":

           use re 'eval';       # throw caution out the door
           $bar = 5;
           $pat = '(?{ 1 })';
           /foo${pat}bar/;      # compiles ok

       Another form of code expression is the pattern code expression.  The
       pattern code expression is like a regular code expression, except that
       the result of the code evaluation is treated as a regular expression
       and matched immediately.  A simple example is

           $length = 5;
           $char = 'a';
           $x = 'aaaaabb';
           $x =~ /(??{$char x $length})/x; # matches, there are 5 of 'a'

       This final example contains both ordinary and pattern code expressions.
       It detects whether a binary string 1101010010001... has a Fibonacci
       spacing 0,1,1,2,3,5,...  of the '1''s:

           $x = "1101010010001000001";
           $z0 = ''; $z1 = '0';   # initial conditions
           print "It is a Fibonacci sequence\n"
               if $x =~ /^1         # match an initial '1'
                           (?:
                              ((??{ $z0 })) # match some '0'
                              1             # and then a '1'
                              (?{ $z0 = $z1; $z1 .= $^N; })
                           )+   # repeat as needed
                         $      # that is all there is
                        /x;
           printf "Largest sequence matched was %d\n", length($z1)-length($z0);

       Remember that $^N is set to whatever was matched by the last completed
       capture group. This prints

           It is a Fibonacci sequence
           Largest sequence matched was 5

       Ha! Try that with your garden variety regexp package...

       Note that the variables $z0 and $z1 are not substituted when the regexp
       is compiled, as happens for ordinary variables outside a code
       expression.  Rather, the whole code block is parsed as perl code at the
       same time as perl is compiling the code containing the literal regexp
       pattern.

       This regexp without the "/x" modifier is

           /^1(?:((??{ $z0 }))1(?{ $z0 = $z1; $z1 .= $^N; }))+$/

       which shows that spaces are still possible in the code parts.
       Nevertheless, when working with code and conditional expressions, the
       extended form of regexps is almost necessary in creating and debugging
       regexps.

   Backtracking control verbs
       Perl 5.10 introduced a number of control verbs intended to provide
       detailed control over the backtracking process, by directly influencing
       the regexp engine and by providing monitoring techniques.  See "Special
       Backtracking Control Verbs" in perlre for a detailed description.

       Below is just one example, illustrating the control verb "(*FAIL)",
       which may be abbreviated as "(*F)". If this is inserted in a regexp it
       will cause it to fail, just as it would at some mismatch between the
       pattern and the string. Processing of the regexp continues as it would
       after any "normal" failure, so that, for instance, the next position in
       the string or another alternative will be tried. As failing to match
       doesn't preserve capture groups or produce results, it may be necessary
       to use this in combination with embedded code.

          %count = ();
          "supercalifragilisticexpialidocious" =~
              /([aeiou])(?{ $count{$1}++; })(*FAIL)/i;
          printf "%3d '%s'\n", $count{$_}, $_ for (sort keys %count);

       The pattern begins with a class matching a subset of letters.  Whenever
       this matches, a statement like "$count{'a'}++;" is executed,
       incrementing the letter's counter. Then "(*FAIL)" does what it says,
       and the regexp engine proceeds according to the book: as long as the
       end of the string hasn't been reached, the position is advanced before
       looking for another vowel. Thus, match or no match makes no difference,
       and the regexp engine proceeds until the entire string has been
       inspected.  (It's remarkable that an alternative solution using
       something like

          $count{lc($_)}++ for split('', "supercalifragilisticexpialidocious");
          printf "%3d '%s'\n", $count2{$_}, $_ for ( qw{ a e i o u } );

       is considerably slower.)

   Pragmas and debugging
       Speaking of debugging, there are several pragmas available to control
       and debug regexps in Perl.  We have already encountered one pragma in
       the previous section, "use re 'eval';", that allows variable
       interpolation and code expressions to coexist in a regexp.  The other
       pragmas are

           use re 'taint';
           $tainted = <>;
           @parts = ($tainted =~ /(\w+)\s+(\w+)/; # @parts is now tainted

       The "taint" pragma causes any substrings from a match with a tainted
       variable to be tainted as well.  This is not normally the case, as
       regexps are often used to extract the safe bits from a tainted
       variable.  Use "taint" when you are not extracting safe bits, but are
       performing some other processing.  Both "taint" and "eval" pragmas are
       lexically scoped, which means they are in effect only until the end of
       the block enclosing the pragmas.

           use re '/m';  # or any other flags
           $multiline_string =~ /^foo/; # /m is implied

       The "re '/flags'" pragma (introduced in Perl 5.14) turns on the given
       regular expression flags until the end of the lexical scope.  See
       "'/flags' mode" in re for more detail.

           use re 'debug';
           /^(.*)$/s;       # output debugging info

           use re 'debugcolor';
           /^(.*)$/s;       # output debugging info in living color

       The global "debug" and "debugcolor" pragmas allow one to get detailed
       debugging info about regexp compilation and execution.  "debugcolor" is
       the same as debug, except the debugging information is displayed in
       color on terminals that can display termcap color sequences.  Here is
       example output:

           % perl -e 'use re "debug"; "abc" =~ /a*b+c/;'
           Compiling REx 'a*b+c'
           size 9 first at 1
              1: STAR(4)
              2:   EXACT <a>(0)
              4: PLUS(7)
              5:   EXACT <b>(0)
              7: EXACT <c>(9)
              9: END(0)
           floating 'bc' at 0..2147483647 (checking floating) minlen 2
           Guessing start of match, REx 'a*b+c' against 'abc'...
           Found floating substr 'bc' at offset 1...
           Guessed: match at offset 0
           Matching REx 'a*b+c' against 'abc'
             Setting an EVAL scope, savestack=3
              0 <> <abc>           |  1:  STAR
                                    EXACT <a> can match 1 times out of 32767...
             Setting an EVAL scope, savestack=3
              1 <a> <bc>           |  4:    PLUS
                                    EXACT <b> can match 1 times out of 32767...
             Setting an EVAL scope, savestack=3
              2 <ab> <c>           |  7:      EXACT <c>
              3 <abc> <>           |  9:      END
           Match successful!
           Freeing REx: 'a*b+c'

       If you have gotten this far into the tutorial, you can probably guess
       what the different parts of the debugging output tell you.  The first
       part

           Compiling REx 'a*b+c'
           size 9 first at 1
              1: STAR(4)
              2:   EXACT <a>(0)
              4: PLUS(7)
              5:   EXACT <b>(0)
              7: EXACT <c>(9)
              9: END(0)

       describes the compilation stage.  STAR(4) means that there is a starred
       object, in this case 'a', and if it matches, goto line 4, i.e.,
       PLUS(7).  The middle lines describe some heuristics and optimizations
       performed before a match:

           floating 'bc' at 0..2147483647 (checking floating) minlen 2
           Guessing start of match, REx 'a*b+c' against 'abc'...
           Found floating substr 'bc' at offset 1...
           Guessed: match at offset 0

       Then the match is executed and the remaining lines describe the
       process:

           Matching REx 'a*b+c' against 'abc'
             Setting an EVAL scope, savestack=3
              0 <> <abc>           |  1:  STAR
                                    EXACT <a> can match 1 times out of 32767...
             Setting an EVAL scope, savestack=3
              1 <a> <bc>           |  4:    PLUS
                                    EXACT <b> can match 1 times out of 32767...
             Setting an EVAL scope, savestack=3
              2 <ab> <c>           |  7:      EXACT <c>
              3 <abc> <>           |  9:      END
           Match successful!
           Freeing REx: 'a*b+c'

       Each step is of the form "n <x> <y>", with "<x>" the part of the string
       matched and "<y>" the part not yet matched.  The "|  1:  STAR" says
       that Perl is at line number 1 in the compilation list above.  See
       "Debugging Regular Expressions" in perldebguts for much more detail.

       An alternative method of debugging regexps is to embed "print"
       statements within the regexp.  This provides a blow-by-blow account of
       the backtracking in an alternation:

           "that this" =~ m@(?{print "Start at position ", pos, "\n";})
                            t(?{print "t1\n";})
                            h(?{print "h1\n";})
                            i(?{print "i1\n";})
                            s(?{print "s1\n";})
                                |
                            t(?{print "t2\n";})
                            h(?{print "h2\n";})
                            a(?{print "a2\n";})
                            t(?{print "t2\n";})
                            (?{print "Done at position ", pos, "\n";})
                           @x;

       prints

           Start at position 0
           t1
           h1
           t2
           h2
           a2
           t2
           Done at position 4

SEE ALSO
       This is just a tutorial.  For the full story on Perl regular
       expressions, see the perlre regular expressions reference page.

       For more information on the matching "m//" and substitution "s///"
       operators, see "Regexp Quote-Like Operators" in perlop.  For
       information on the "split" operation, see "split" in perlfunc.

       For an excellent all-around resource on the care and feeding of regular
       expressions, see the book Mastering Regular Expressions by Jeffrey
       Friedl (published by O'Reilly, ISBN 1556592-257-3).

AUTHOR AND COPYRIGHT
       Copyright (c) 2000 Mark Kvale.  All rights reserved.  Now maintained by
       Perl porters.

       This document may be distributed under the same terms as Perl itself.

   Acknowledgments
       The inspiration for the stop codon DNA example came from the ZIP code
       example in chapter 7 of Mastering Regular Expressions.

       The author would like to thank Jeff Pinyan, Andrew Johnson, Peter
       Haworth, Ronald J Kimball, and Joe Smith for all their helpful
       comments.

perl v5.34.0                      2026-06-23                      PERLRETUT(1)

Generated by dwww version 1.14 on Mon Aug 3 11:05:52 CEST 2026.